Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8121272.1

Orthogroup ID

OG0005669

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 570

Gene Structure 570 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8121272.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 446 bp

cacagttggacaggattttacctgaccaggcttccctatgttgcgactcggagaaggcactgtgttgtagtgtcatcaactcttctgcttcagatgacactccaacaccaaagtcttctgcagagctggaggaggagattgccacacttgagcttgagattttgcatttagaacgccatcttctttcactatatagaacagcttttcaaggatgtgcctttccaagtaccccggatagccatatacaatttatgacacgatcgccattaaaagttgtacagaagcaaccacgttccagtttggagttgcaaatgcacagaggtggacctttccgtcatgaccaaacttccccttcacctagtcggttccactcagatcatcacagcagtgccaccagcataaaagcaacacctaaaagggtaaatattcctggcaagcgagattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF547 Lzipper-MIP1

Protein Analysis

147

Amino Acids

16.36

Weight (kDa)

6.77

Isoelectric Point (pI)

69.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005669)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21060 AT1G21060 AT1G76620 AT1G76620
fragaria_vesca	FvH4_5g26610 FvH4_5g26610
malus_domestica	MD06G1001000.v1.1
prunus_persica	Prupe.5G001300_v2.0.a1 Prupe.5G001300_v2.0.a1 Prupe.5G001300_v2.0.a1 Prupe.5G001300_v2.0.a1 Prupe.5G001300_v2.0.a1
pyrus_communis	pycom06g00020
rosa_chinensis	RchiOBHm_Chr7g0217551
rosa_laevigata	RLG00000002462
rosa_multiflora	Rmu_co8121272.1_g000001 Rmu_co8214236.1_g000001 Rmu_sc0004631.1_g000001 Rmu_sc0006161.1_g000005
rosa_roxburghii	Rroxscaffold_3G00241880
rosa_rugosa	Rorug07G0169700 Rorug07G0169700 Rorug07G0169800
rosa_samantha	Rh7AG309700 Rh7BG300800 Rh7CG328900 Rh7DG309300
rosa_wichuraiana	Rw7G026270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	332
AcuI	CTGAAG	1 cut(s)	74
AfaI	GTAC	2 cut(s)	228, 278
AgsI	TTSAA	1 cut(s)	208
AjnI	CCWGG	2 cut(s)	26, 429
AleI	CACNNNNGTG	2 cut(s)	320, 386
AluBI	AGCT	3 cut(s)	126, 153, 202
AluI	AGCT	3 cut(s)	126, 153, 202
AspS9I	GGNCC	1 cut(s)	325
AsuC2I	CCSGG	1 cut(s)	232
AsuHPI	GGTGA	1 cut(s)	347
AvaII	GGWCC	1 cut(s)	325
BbsI	GAAGAC	1 cut(s)	107
BccI	CCATC	1 cut(s)	185
BciT130I	CCWGG	2 cut(s)	28, 431
BcnI	CCSGG	1 cut(s)	232
BfaI	CTAG	1 cut(s)	359
BfmI	CTRYAG	1 cut(s)	119
Bme1390I	CCNGG	3 cut(s)	28, 232, 431
Bme18I	GGWCC	1 cut(s)	325
BmgT120I	GGNCC	1 cut(s)	325
BmiI	GGNNCC	1 cut(s)	367
BmrFI	CCNGG	3 cut(s)	28, 232, 431
BpiI	GAAGAC	1 cut(s)	107
BpmI	CTGGAG	1 cut(s)	148
BpuEI	CTTGAG	2 cut(s)	169, 175
BpuMI	CCSGG	1 cut(s)	232
BsaJI	CCNNGG	1 cut(s)	230
Bse1I	ACTGG	1 cut(s)	296
BseBI	CCWGG	2 cut(s)	28, 431
BseDI	CCNNGG	1 cut(s)	230
BseGI	GGATG	1 cut(s)	217
BseMII	CTCAG	1 cut(s)	386
BseNI	ACTGG	1 cut(s)	296
BseRI	GAGGAG	2 cut(s)	145, 148
Bsh1285I	CGRYCG	1 cut(s)	262
BsiEI	CGRYCG	1 cut(s)	262
BsiSI	CCGG	1 cut(s)	232
Bsp1407I	TGTACA	1 cut(s)	276
Bsp143I	GATC	2 cut(s)	259, 375
BspCNI	CTCAG	1 cut(s)	385
BspHI	TCATGA	1 cut(s)	336
BspLI	GGNNCC	1 cut(s)	367
BspMAI	CTGCAG	1 cut(s)	123
BsrGI	TGTACA	1 cut(s)	276
BsrI	ACTGG	1 cut(s)	296
BssECI	CCNNGG	1 cut(s)	230
BssMI	GATC	2 cut(s)	259, 375
Bst2UI	CCWGG	2 cut(s)	28, 431
Bst4CI	ACNGT	2 cut(s)	5, 62
Bst6I	CTCTTC	1 cut(s)	87
BstAUI	TGTACA	1 cut(s)	276
BstC8I	GCNNGC	1 cut(s)	436
BstDEI	CTNAG	1 cut(s)	372
BstF5I	GGATG	1 cut(s)	217
BstKTI	GATC	2 cut(s)	262, 378
BstMBI	GATC	2 cut(s)	259, 375
BstMCI	CGRYCG	1 cut(s)	262
BstNI	CCWGG	2 cut(s)	28, 431
BstSCI	CCNGG	3 cut(s)	26, 230, 429
BstSFI	CTRYAG	1 cut(s)	119
BstV2I	GAAGAC	1 cut(s)	107
BtsCI	GGATG	1 cut(s)	217
BtsI	GCAGTG	1 cut(s)	393
BtsIMutI	CAGTG	2 cut(s)	58, 393
Cac8I	GCNNGC	1 cut(s)	436
CciI	TCATGA	1 cut(s)	336
Cfr13I	GGNCC	1 cut(s)	325
Csp6I	GTAC	2 cut(s)	227, 277
CviAII	CATG	1 cut(s)	337
CviJI	RGCY	5 cut(s)	31, 126, 153, 202, 239
CviKI_1	RGCY	5 cut(s)	31, 126, 153, 202, 239
CviQI	GTAC	2 cut(s)	227, 277
DdeI	CTNAG	1 cut(s)	372
DpnI	GATC	2 cut(s)	261, 377
DpnII	GATC	2 cut(s)	259, 375
DrdI	GACNNNNNNGTC	1 cut(s)	332
DseDI	GACNNNNNNGTC	1 cut(s)	332
Eam1104I	CTCTTC	1 cut(s)	87
EarI	CTCTTC	1 cut(s)	87
Eco47I	GGWCC	1 cut(s)	325
Eco57I	CTGAAG	1 cut(s)	74
EcoRII	CCWGG	2 cut(s)	26, 429
FaeI	CATG	1 cut(s)	340
FaiI	YATR	8 cut(s)	39, 192, 194, 242, 244, 253, 338, 400
FatI	CATG	1 cut(s)	336
FokI	GGATG	1 cut(s)	224
FspBI	CTAG	1 cut(s)	359
GsuI	CTGGAG	1 cut(s)	148
HapII	CCGG	1 cut(s)	232
Hin1II	CATG	1 cut(s)	340
HinfI	GANTC	1 cut(s)	46
HpaII	CCGG	1 cut(s)	232
HphI	GGTGA	1 cut(s)	347
Hpy166II	GTNNAC	1 cut(s)	325
Hpy188I	TCNGA	3 cut(s)	51, 93, 375
Hpy188III	TCNNGA	1 cut(s)	337
Hpy8I	GTNNAC	1 cut(s)	325
HpyAV	CCTTC	2 cut(s)	48, 362
HpyCH4III	ACNGT	2 cut(s)	5, 62
HpyCH4IV	ACGT	1 cut(s)	291
HpyCH4V	TGCA	4 cut(s)	121, 165, 309, 315
HpyF3I	CTNAG	1 cut(s)	372
HpySE526I	ACGT	1 cut(s)	291
Hsp92II	CATG	1 cut(s)	340
Kzo9I	GATC	2 cut(s)	259, 375
LpnPI	CCDG	8 cut(s)	13, 35, 40, 112, 245, 309, 408, 416
MaeI	CTAG	1 cut(s)	359
MaeII	ACGT	1 cut(s)	291
MalI	GATC	2 cut(s)	261, 377
MboI	GATC	2 cut(s)	259, 375
MboII	GAAGA	3 cut(s)	74, 107, 172
MluCI	AATT	1 cut(s)	247
MlyI	GAGTC	1 cut(s)	40
MmeI	TCCRAC	1 cut(s)	127
MnlI	CCTC	3 cut(s)	123, 126, 313
MseI	TTAA	1 cut(s)	268
MslI	CAYNNNNRTG	2 cut(s)	320, 386
MspI	CCGG	1 cut(s)	232
MspR9I	CCNGG	3 cut(s)	28, 232, 431
MvaI	CCWGG	2 cut(s)	28, 431
NciI	CCSGG	1 cut(s)	232
NdeII	GATC	2 cut(s)	259, 375
NlaIII	CATG	1 cut(s)	340
NlaIV	GGNNCC	1 cut(s)	367
OliI	CACNNNNGTG	2 cut(s)	320, 386
PagI	TCATGA	1 cut(s)	336
Ple19I	CGATCG	1 cut(s)	262
PleI	GAGTC	1 cut(s)	40
PpsI	GAGTC	1 cut(s)	40
Psp6I	CCWGG	2 cut(s)	26, 429
PspGI	CCWGG	2 cut(s)	26, 429
PspN4I	GGNNCC	1 cut(s)	367
PspPI	GGNCC	1 cut(s)	325
PstI	CTGCAG	1 cut(s)	123
PvuI	CGATCG	1 cut(s)	262
RsaI	GTAC	2 cut(s)	228, 278
RsaNI	GTAC	2 cut(s)	227, 277
RseI	CAYNNNNRTG	2 cut(s)	320, 386
SaqAI	TTAA	1 cut(s)	268
Sau3AI	GATC	2 cut(s)	259, 375
Sau96I	GGNCC	1 cut(s)	325
SchI	GAGTC	1 cut(s)	40
ScrFI	CCNGG	3 cut(s)	28, 232, 431
SetI	ASST	9 cut(s)	24, 128, 155, 204, 294, 324, 330, 360, 414
SfcI	CTRYAG	1 cut(s)	119
SinI	GGWCC	1 cut(s)	325
SmiMI	CAYNNNNRTG	2 cut(s)	320, 386
SmlI	CTYRAG	2 cut(s)	148, 154
SmoI	CTYRAG	2 cut(s)	148, 154
Sse9I	AATT	1 cut(s)	247
SspI	AATATT	1 cut(s)	426
SspMI	CTAG	1 cut(s)	359
StyD4I	CCNGG	3 cut(s)	26, 230, 429
TaaI	ACNGT	2 cut(s)	5, 62
TaiI	ACGT	1 cut(s)	294
TasI	AATT	1 cut(s)	247
TatI	WGTACW	1 cut(s)	276
Tru1I	TTAA	1 cut(s)	268
Tru9I	TTAA	1 cut(s)	268
TscAI	CASTG	2 cut(s)	65, 393
TspGWI	ACGGA	1 cut(s)	322
TspRI	CASTG	2 cut(s)	65, 393
VpaK11BI	GGWCC	1 cut(s)	325
XspI	CTAG	1 cut(s)	359

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.