Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8126840.1

Orthogroup ID

OG0008786

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 583

Gene Structure 583 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8126840.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

atggccattgcaagaagatttgacacgataatggcgctcaggatgggtgtttataatgtcatgcttcttgggtttgcaatggcttggcttttttgcgtggtcgatggtgcttcacgtcggcatgttttcgaagtaggtagccgtggtcgccttcccgatcataacaccatcagaacagttttggaagttgccacctccaagggagaaattaagcctctcaacgagacagaagctgcacag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

80

Amino Acids

8.94

Weight (kDa)

9.18

Isoelectric Point (pI)

36.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008786)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G06925 AT2G06925
fragaria_vesca	FvH4_4g06380
malus_domestica	MD13G1235500.v1.1 MD16G1240200.v1.1
prunus_persica	Prupe.1G066500_v2.0.a1 Prupe.1G066500_v2.0.a1 Prupe.1G066900_v2.0.a1 Prupe.1G066900_v2.0.a1
pyrus_communis	pycom13g20800 pycom16g20100
rosa_chinensis	RchiOBHm_Chr4g0398131
rosa_laevigata	RLG00000009384
rosa_multiflora	Rmu_co8126840.1_g000001 Rmu_sc0009399.1_g000001
rosa_roxburghii	Rroxscaffold_5G00343030
rosa_rugosa	Rorug04G0006100 Rorug04G0006200
rosa_samantha	Rh4AG083300 Rh4BG081000 Rh4CG090300 Rh4DG075900
rosa_wichuraiana	Rw4G006920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	54
AcoI	YGGCCR	1 cut(s)	3
AjiI	CACGTC	1 cut(s)	116
AluBI	AGCT	1 cut(s)	233
AluI	AGCT	1 cut(s)	233
Alw26I	GTCTC	1 cut(s)	218
AlwNI	CAGNNNCTG	1 cut(s)	233
AoxI	GGCC	1 cut(s)	3
ApeKI	GCWGC	1 cut(s)	233
AspLEI	GCGC	1 cut(s)	37
AsuII	TTCGAA	1 cut(s)	129
BalI	TGGCCA	1 cut(s)	5
BbvI	GCAGC	1 cut(s)	220
BccI	CCATC	3 cut(s)	37, 98, 176
BceAI	ACGGC	1 cut(s)	126
BcoDI	GTCTC	1 cut(s)	218
BfoI	RGCGCY	1 cut(s)	38
BisI	GCNGC	1 cut(s)	234
BlsI	GCNGC	1 cut(s)	235
BmgBI	CACGTC	1 cut(s)	116
Bpu10I	CCTNAGC	1 cut(s)	38
Bpu14I	TTCGAA	1 cut(s)	129
BsaJI	CCNNGG	2 cut(s)	142, 198
Bse3DI	GCAATG	2 cut(s)	6, 84
BseDI	CCNNGG	2 cut(s)	142, 198
BseGI	GGATG	1 cut(s)	48
BseMI	GCAATG	2 cut(s)	6, 84
BseMII	CTCAG	1 cut(s)	52
BseXI	GCAGC	1 cut(s)	220
BsgI	GTGCAG	1 cut(s)	219
BshFI	GGCC	1 cut(s)	5
BsmAI	GTCTC	1 cut(s)	218
BsnI	GGCC	1 cut(s)	5
Bsp119I	TTCGAA	1 cut(s)	129
Bsp143I	GATC	1 cut(s)	157
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	1 cut(s)	51
BspT104I	TTCGAA	1 cut(s)	129
BsrDI	GCAATG	2 cut(s)	6, 84
BssECI	CCNNGG	2 cut(s)	142, 198
BssMI	GATC	1 cut(s)	157
BssT1I	CCWWGG	1 cut(s)	198
Bst4CI	ACNGT	1 cut(s)	178
BstBI	TTCGAA	1 cut(s)	129
BstDEI	CTNAG	1 cut(s)	38
BstDSI	CCRYGG	1 cut(s)	142
BstF5I	GGATG	1 cut(s)	48
BstH2I	RGCGCY	1 cut(s)	38
BstHHI	GCGC	1 cut(s)	37
BstKTI	GATC	1 cut(s)	160
BstMAI	GTCTC	1 cut(s)	218
BstMBI	GATC	1 cut(s)	157
BstMWI	GCNNNNNNNGC	1 cut(s)	147
BstNSI	RCATGY	1 cut(s)	125
BstV1I	GCAGC	1 cut(s)	220
BsuRI	GGCC	1 cut(s)	5
BtgI	CCRYGG	1 cut(s)	142
BtrI	CACGTC	1 cut(s)	116
BtsCI	GGATG	1 cut(s)	48
CaiI	CAGNNNCTG	1 cut(s)	233
CfoI	GCGC	1 cut(s)	37
CviAII	CATG	2 cut(s)	61, 122
CviJI	RGCY	6 cut(s)	5, 83, 88, 141, 214, 233
CviKI_1	RGCY	6 cut(s)	5, 83, 88, 141, 214, 233
DdeI	CTNAG	1 cut(s)	38
DpnI	GATC	1 cut(s)	159
DpnII	GATC	1 cut(s)	157
EaeI	YGGCCR	1 cut(s)	3
Eco130I	CCWWGG	1 cut(s)	198
EcoT14I	CCWWGG	1 cut(s)	198
ErhI	CCWWGG	1 cut(s)	198
FaeI	CATG	2 cut(s)	64, 125
FaiI	YATR	4 cut(s)	54, 62, 123, 162
FatI	CATG	2 cut(s)	60, 121
Fnu4HI	GCNGC	1 cut(s)	234
FokI	GGATG	1 cut(s)	55
Fsp4HI	GCNGC	1 cut(s)	234
GlaI	GCGC	1 cut(s)	36
GluI	GCNGC	1 cut(s)	234
HaeII	RGCGCY	1 cut(s)	38
HaeIII	GGCC	1 cut(s)	5
HhaI	GCGC	1 cut(s)	37
Hin1II	CATG	2 cut(s)	64, 125
Hin6I	GCGC	1 cut(s)	35
HinP1I	GCGC	1 cut(s)	35
Hpy188I	TCNGA	1 cut(s)	173
Hpy188III	TCNNGA	2 cut(s)	40, 155
Hpy99I	CGWCG	1 cut(s)	120
HpyAV	CCTTC	1 cut(s)	161
HpyCH4III	ACNGT	1 cut(s)	178
HpyCH4IV	ACGT	1 cut(s)	115
HpyCH4V	TGCA	3 cut(s)	11, 77, 236
HpyF10VI	GCNNNNNNNGC	1 cut(s)	147
HpyF3I	CTNAG	1 cut(s)	38
HpySE526I	ACGT	1 cut(s)	115
Hsp92II	CATG	2 cut(s)	64, 125
HspAI	GCGC	1 cut(s)	35
Kzo9I	GATC	1 cut(s)	157
LpnPI	CCDG	1 cut(s)	25
Lsp1109I	GCAGC	1 cut(s)	220
MaeII	ACGT	1 cut(s)	115
MalI	GATC	1 cut(s)	159
MboI	GATC	1 cut(s)	157
MboII	GAAGA	1 cut(s)	27
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	1 cut(s)	207
MluNI	TGGCCA	1 cut(s)	5
MnlI	CCTC	2 cut(s)	205, 225
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	1 cut(s)	210
MslI	CAYNNNNRTG	1 cut(s)	29
Msp20I	TGGCCA	1 cut(s)	5
MwoI	GCNNNNNNNGC	1 cut(s)	147
NdeII	GATC	1 cut(s)	157
NlaIII	CATG	2 cut(s)	64, 125
NspI	RCATGY	1 cut(s)	125
NspV	TTCGAA	1 cut(s)	129
PkrI	GCNGC	1 cut(s)	235
PsiI	TTATAA	1 cut(s)	54
PstNI	CAGNNNCTG	1 cut(s)	233
RseI	CAYNNNNRTG	1 cut(s)	29
SaqAI	TTAA	1 cut(s)	210
SatI	GCNGC	1 cut(s)	234
Sau3AI	GATC	1 cut(s)	157
SetI	ASST	4 cut(s)	118, 139, 197, 235
SfuI	TTCGAA	1 cut(s)	129
SmiMI	CAYNNNNRTG	1 cut(s)	29
Sse9I	AATT	1 cut(s)	207
StyI	CCWWGG	1 cut(s)	198
TaaI	ACNGT	1 cut(s)	178
TaiI	ACGT	1 cut(s)	118
TaqI	TCGA	2 cut(s)	102, 129
TasI	AATT	1 cut(s)	207
Tru1I	TTAA	1 cut(s)	210
Tru9I	TTAA	1 cut(s)	210
TseI	GCWGC	1 cut(s)	233
XceI	RCATGY	1 cut(s)	125

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.