Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8159618.1

Orthogroup ID

OG0007318

Physical Location & Seq

Genomic Coordinates Reverse (-)

34 .. 339

Gene Structure 306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8159618.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

atgggtcgtcttgcaccattatcagaagaacccaatattaatgaagaagaagatgccacaaatcgctcaagcaaaggcataatgaggagtcagacatggaggaaatggatcaagacccacctcacctcccttgccatcttcaacaagaggtctgacttcaaggtcctcctcagcgttctgggttgccctctcttccctgtctctgccctccccaaactgtccctcaatgaggtacgttattaccaactcctgcattccttggaacttaatttttcccaggtttatgacgatttggggttggtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF620

Protein Analysis

101

Amino Acids

11.58

Weight (kDa)

7.89

Isoelectric Point (pI)

53.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007318)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G06610
fragaria_vesca	FvH4_6g21510 FvH4_6g21510
malus_domestica	MD12G1052000.v1.1 MD14G1050800.v1.1
prunus_persica	Prupe.7G085100_v2.0.a1 Prupe.7G085100_v2.0.a1 Prupe.7G085100_v2.0.a1
pyrus_communis	pycom12g04580 pycom14g04210
rosa_chinensis	RchiOBHm_Chr3g0478731
rosa_laevigata	RLG00000023629
rosa_multiflora	Rmu_co8159618.1_g000001 Rmu_sc0001519.1_g000010 Rmu_sc0001519.1_g000011 Rmu_sc0008074.1_g000002 Rmu_sc0008074.1_g000003
rosa_roxburghii	Rroxscaffold_6G00403120
rosa_rugosa	Rorug03G0167500
rosa_samantha	Rh3AG219600 Rh3BG251400 Rh3CG248300 Rh3CG248400 Rh3DG244600
rosa_wichuraiana	Rw3G019730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	161
AclWI	GGATC	1 cut(s)	116
AfaI	GTAC	1 cut(s)	234
AfiI	CCNNNNNNNGG	1 cut(s)	229
AgsI	TTSAA	2 cut(s)	142, 160
AjnI	CCWGG	1 cut(s)	276
Alw26I	GTCTC	1 cut(s)	205
AlwI	GGATC	1 cut(s)	116
AseI	ATTAAT	1 cut(s)	39
AspS9I	GGNCC	1 cut(s)	163
AsuHPI	GGTGA	1 cut(s)	115
AvaII	GGWCC	1 cut(s)	163
BbvCI	CCTCAGC	1 cut(s)	170
BccI	CCATC	1 cut(s)	143
BciT130I	CCWGG	1 cut(s)	278
BcoDI	GTCTC	1 cut(s)	205
Bme1390I	CCNGG	1 cut(s)	278
Bme18I	GGWCC	1 cut(s)	163
BmgT120I	GGNCC	1 cut(s)	163
BmrFI	CCNGG	1 cut(s)	278
BmsI	GCATC	1 cut(s)	43
Bpu10I	CCTNAGC	1 cut(s)	170
BpuEI	CTTGAG	1 cut(s)	52
BsaJI	CCNNGG	2 cut(s)	258, 276
BsaXI	ACNNNNNCTCC	2 cut(s)	110, 140
Bsc4I	CCNNNNNNNGG	1 cut(s)	229
BseBI	CCWGG	1 cut(s)	278
BseDI	CCNNGG	2 cut(s)	258, 276
BseLI	CCNNNNNNNGG	1 cut(s)	229
BseMII	CTCAG	1 cut(s)	184
BseRI	GAGGAG	2 cut(s)	100, 158
BslFI	GGGAC	1 cut(s)	205
BslI	CCNNNNNNNGG	1 cut(s)	229
BsmAI	GTCTC	1 cut(s)	205
BsmFI	GGGAC	1 cut(s)	205
BsmI	GAATGC	1 cut(s)	253
Bsp143I	GATC	1 cut(s)	108
BspCNI	CTCAG	1 cut(s)	183
BspPI	GGATC	1 cut(s)	116
BssECI	CCNNGG	2 cut(s)	258, 276
BssMI	GATC	1 cut(s)	108
BssT1I	CCWWGG	1 cut(s)	258
Bst2UI	CCWGG	1 cut(s)	278
Bst4CI	ACNGT	1 cut(s)	219
Bst6I	CTCTTC	1 cut(s)	197
BstDEI	CTNAG	1 cut(s)	170
BstENI	CCTNNNNNAGG	1 cut(s)	227
BstKTI	GATC	1 cut(s)	111
BstMAI	GTCTC	1 cut(s)	205
BstMBI	GATC	1 cut(s)	108
BstNI	CCWGG	1 cut(s)	278
BstSCI	CCNGG	1 cut(s)	276
Cfr13I	GGNCC	1 cut(s)	163
Csp6I	GTAC	1 cut(s)	233
CviAII	CATG	1 cut(s)	96
CviQI	GTAC	1 cut(s)	233
DdeI	CTNAG	1 cut(s)	170
DpnI	GATC	1 cut(s)	110
DpnII	GATC	1 cut(s)	108
DrdI	GACNNNNNNGTC	1 cut(s)	161
DseDI	GACNNNNNNGTC	1 cut(s)	161
Eam1104I	CTCTTC	1 cut(s)	197
EarI	CTCTTC	1 cut(s)	197
Eco130I	CCWWGG	1 cut(s)	258
Eco47I	GGWCC	1 cut(s)	163
EcoNI	CCTNNNNNAGG	1 cut(s)	227
EcoO109I	RGGNCCY	1 cut(s)	163
EcoRII	CCWGG	1 cut(s)	276
EcoT14I	CCWWGG	1 cut(s)	258
ErhI	CCWWGG	1 cut(s)	258
FaeI	CATG	1 cut(s)	99
FaiI	YATR	3 cut(s)	80, 97, 285
FaqI	GGGAC	1 cut(s)	205
FatI	CATG	1 cut(s)	95
Hin1II	CATG	1 cut(s)	99
HinfI	GANTC	1 cut(s)	88
HphI	GGTGA	1 cut(s)	115
Hpy188I	TCNGA	3 cut(s)	25, 93, 154
Hpy188III	TCNNGA	1 cut(s)	112
HpyCH4III	ACNGT	1 cut(s)	219
HpyCH4IV	ACGT	1 cut(s)	235
HpyCH4V	TGCA	2 cut(s)	14, 253
HpyF3I	CTNAG	1 cut(s)	170
HpySE526I	ACGT	1 cut(s)	235
Hsp92II	CATG	1 cut(s)	99
Kzo9I	GATC	1 cut(s)	108
LpnPI	CCDG	5 cut(s)	164, 210, 263, 263, 290
LweI	GCATC	1 cut(s)	43
MaeII	ACGT	1 cut(s)	235
MalI	GATC	1 cut(s)	110
MboI	GATC	1 cut(s)	108
MboII	GAAGA	6 cut(s)	38, 56, 59, 62, 130, 184
MluCI	AATT	1 cut(s)	268
MlyI	GAGTC	1 cut(s)	97
MseI	TTAA	2 cut(s)	39, 267
MspR9I	CCNGG	1 cut(s)	278
Mva1269I	GAATGC	1 cut(s)	253
MvaI	CCWGG	1 cut(s)	278
NdeII	GATC	1 cut(s)	108
NlaIII	CATG	1 cut(s)	99
PctI	GAATGC	1 cut(s)	253
PleI	GAGTC	1 cut(s)	96
PpsI	GAGTC	1 cut(s)	96
PpuMI	RGGWCCY	1 cut(s)	163
PshBI	ATTAAT	1 cut(s)	39
Psp5II	RGGWCCY	1 cut(s)	163
Psp6I	CCWGG	1 cut(s)	276
PspGI	CCWGG	1 cut(s)	276
PspPI	GGNCC	1 cut(s)	163
PspPPI	RGGWCCY	1 cut(s)	163
RsaI	GTAC	1 cut(s)	234
RsaNI	GTAC	1 cut(s)	233
SaqAI	TTAA	2 cut(s)	39, 267
Sau3AI	GATC	1 cut(s)	108
Sau96I	GGNCC	1 cut(s)	163
SchI	GAGTC	1 cut(s)	97
ScrFI	CCNGG	1 cut(s)	278
SetI	ASST	7 cut(s)	123, 128, 152, 165, 234, 238, 282
SfaNI	GCATC	1 cut(s)	43
SinI	GGWCC	1 cut(s)	163
SmlI	CTYRAG	1 cut(s)	67
SmoI	CTYRAG	1 cut(s)	67
Sse9I	AATT	1 cut(s)	268
SspI	AATATT	1 cut(s)	37
StyD4I	CCNGG	1 cut(s)	276
StyI	CCWWGG	1 cut(s)	258
TaaI	ACNGT	1 cut(s)	219
TaiI	ACGT	1 cut(s)	238
TasI	AATT	1 cut(s)	268
Tru1I	TTAA	2 cut(s)	39, 267
Tru9I	TTAA	2 cut(s)	39, 267
TspDTI	ATGAA	1 cut(s)	57
VpaK11BI	GGWCC	1 cut(s)	163
VspI	ATTAAT	1 cut(s)	39
XagI	CCTNNNNNAGG	1 cut(s)	227

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.