Rmu_co8197906.1_g000001

CBS domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8197906.1
Physical Location & Seq
Forward (+)
1 .. 635
635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8197906.1_g000001.1.cds

Sequence Viewer

Length: 339 bp
aatggtgaggttattgccttgttggatatcacaaaatgcctctatgatgctatatcaagaatggaaaaggcagctgagcaggggagtgccattgctgctgcagttgaaggagttgaacgccagtggggagccaatttttctgctccatatgcttttctggaaactctgagggagcgaatgttcaagccttcattgtcaaccatcattggtgaaaacacaaaggttgcaattgtatccccatcagaccctgtctatgttgcggcaaaaaagatgcgggactttcgggttaattcagttataattgtcatggggaacaagattcaagggatactcacgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.21

Weight (kDa)

8.06

Isoelectric Point (pI)

25.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 299
AciI CCGC 2 cut(s) 260, 274
AgsI TTSAA 4 cut(s) 107, 116, 184, 323
AloI GAACNNNNNNTCC 2 cut(s) 164, 196
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AlwNI CAGNNNCTG 1 cut(s) 248
ApeKI GCWGC 3 cut(s) 71, 95, 98
AsuHPI GGTGA 2 cut(s) 17, 221
BaeI ACNNNNGTAYC 1 cut(s) 320
BbvI GCAGC 3 cut(s) 82, 83, 85
BccI CCATC 2 cut(s) 209, 247
BciVI GTATCC 2 cut(s) 244, 321
BfmI CTRYAG 1 cut(s) 99
BfuI GTATCC 2 cut(s) 244, 321
BisI GCNGC 4 cut(s) 72, 96, 99, 261
BlpI GCTNAGC 1 cut(s) 75
BlsI GCNGC 4 cut(s) 73, 97, 100, 262
BmiI GGNNCC 1 cut(s) 130
BmsI GCATC 2 cut(s) 37, 261
Bpu1102I GCTNAGC 1 cut(s) 75
BsaAI YACGTR 1 cut(s) 336
BsaXI ACNNNNNCTCC 2 cut(s) 164, 194
Bse1I ACTGG 1 cut(s) 121
Bse3DI GCAATG 1 cut(s) 90
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 2 cut(s) 66, 158
BseNI ACTGG 1 cut(s) 121
BseXI GCAGC 3 cut(s) 82, 83, 85
BslFI GGGAC 1 cut(s) 290
BsmFI GGGAC 1 cut(s) 290
Bsp1720I GCTNAGC 1 cut(s) 75
BspACI CCGC 2 cut(s) 260, 274
BspCNI CTCAG 2 cut(s) 67, 159
BspLI GGNNCC 1 cut(s) 130
BspMAI CTGCAG 1 cut(s) 103
BsrDI GCAATG 1 cut(s) 90
BsrI ACTGG 1 cut(s) 121
BstBAI YACGTR 1 cut(s) 336
BstDEI CTNAG 2 cut(s) 75, 167
BstMWI GCNNNNNNNGC 2 cut(s) 95, 149
BstSFI CTRYAG 1 cut(s) 99
BstV1I GCAGC 3 cut(s) 82, 83, 85
BsuI GTATCC 2 cut(s) 244, 321
BtsIMutI CAGTG 1 cut(s) 128
CaiI CAGNNNCTG 1 cut(s) 248
CviAII CATG 1 cut(s) 307
CviJI RGCY 3 cut(s) 74, 131, 187
CviKI_1 RGCY 3 cut(s) 74, 131, 187
DdeI CTNAG 2 cut(s) 75, 167
Eco32I GATATC 1 cut(s) 28
EcoRV GATATC 1 cut(s) 28
FaeI CATG 1 cut(s) 310
FaiI YATR 7 cut(s) 45, 53, 148, 150, 255, 299, 308
FaqI GGGAC 1 cut(s) 290
FatI CATG 1 cut(s) 306
FauI CCCGC 1 cut(s) 267
FauNDI CATATG 1 cut(s) 148
Fnu4HI GCNGC 4 cut(s) 72, 96, 99, 261
Fsp4HI GCNGC 4 cut(s) 72, 96, 99, 261
GluI GCNGC 4 cut(s) 72, 96, 99, 261
Hin1II CATG 1 cut(s) 310
HincII GTYRAC 1 cut(s) 198
HindII GTYRAC 1 cut(s) 198
HinfI GANTC 1 cut(s) 319
HphI GGTGA 2 cut(s) 17, 221
Hpy166II GTNNAC 1 cut(s) 198
Hpy188I TCNGA 2 cut(s) 168, 244
Hpy188III TCNNGA 2 cut(s) 57, 158
Hpy8I GTNNAC 1 cut(s) 198
HpyAV CCTTC 2 cut(s) 101, 198
HpyCH4IV ACGT 1 cut(s) 335
HpyCH4V TGCA 2 cut(s) 101, 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 149
HpyF3I CTNAG 2 cut(s) 75, 167
HpySE526I ACGT 1 cut(s) 335
Hsp92II CATG 1 cut(s) 310
LmnI GCTCC 3 cut(s) 128, 148, 172
LpnPI CCDG 4 cut(s) 65, 134, 143, 261
Lsp1109I GCAGC 3 cut(s) 82, 83, 85
LweI GCATC 2 cut(s) 37, 261
MaeII ACGT 1 cut(s) 335
MfeI CAATTG 1 cut(s) 228
MluCI AATT 4 cut(s) 133, 228, 289, 300
MnlI CCTC 2 cut(s) 50, 162
MseI TTAA 1 cut(s) 288
MspA1I CMGCKG 1 cut(s) 74
MunI CAATTG 1 cut(s) 228
MwoI GCNNNNNNNGC 2 cut(s) 95, 149
NdeI CATATG 1 cut(s) 148
NlaIII CATG 1 cut(s) 310
NlaIV GGNNCC 1 cut(s) 130
PfeI GAWTC 1 cut(s) 319
PflFI GACNNNGTC 1 cut(s) 248
PkrI GCNGC 4 cut(s) 73, 97, 100, 262
Ppu21I YACGTR 1 cut(s) 336
PsiI TTATAA 1 cut(s) 299
PspN4I GGNNCC 1 cut(s) 130
PstI CTGCAG 1 cut(s) 103
PstNI CAGNNNCTG 1 cut(s) 248
PsyI GACNNNGTC 1 cut(s) 248
PvuII CAGCTG 1 cut(s) 74
SaqAI TTAA 1 cut(s) 288
SatI GCNGC 4 cut(s) 72, 96, 99, 261
SetI ASST 4 cut(s) 12, 76, 225, 338
SfaNI GCATC 2 cut(s) 37, 261
SfcI CTRYAG 1 cut(s) 99
Sse9I AATT 4 cut(s) 133, 228, 289, 300
SsiI CCGC 2 cut(s) 260, 274
TaiI ACGT 1 cut(s) 338
TasI AATT 4 cut(s) 133, 228, 289, 300
TauI GCSGC 1 cut(s) 263
TfiI GAWTC 1 cut(s) 319
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 1 cut(s) 128
TseI GCWGC 3 cut(s) 71, 95, 98
TspDTI ATGAA 1 cut(s) 180
TspRI CASTG 1 cut(s) 128
Tth111I GACNNNGTC 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.