Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8206848.1

Orthogroup ID

OG0002818

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 553

Gene Structure 553 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8206848.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

aaggaaattgaggagcttcgagcgaaattgcaggatactcattcagaacattggacagaggaaatcctcaatttgcggaacacattgttgcagactgagttagaaagggagcgtatagccttggagttggaggaggaaaagaaagcccaagctgaaagagagaagatggtccaacaacaagctaagaaaattgaaaatttgagttcaatggttttgtattcaaatagggatgagaatcgtgatcgcttcaagaaggtttgcgtaatgataaactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000070 GO:0000226 GO:0000278 GO:0000280 GO:0000775 GO:0000776 GO:0000779 GO:0000793 GO:0000819 GO:0001932 GO:0001934 GO:0002376 GO:0002478 GO:0002495 GO:0002504 GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005694 GO:0005737 GO:0005819 GO:0005828 GO:0005829 GO:0005856 GO:0005871 GO:0005874 GO:0005875 GO:0005876 GO:0006810 GO:0006890 GO:0006928 GO:0006996 GO:0007010 GO:0007017 GO:0007018 GO:0007049 GO:0007051 GO:0007052 GO:0007059 GO:0007079 GO:0007080 GO:0007088 GO:0007346 GO:0008017 GO:0008092 GO:0008150 GO:0008608 GO:0009893 GO:0009987 GO:0010562 GO:0010564 GO:0010604 GO:0010965 GO:0015630 GO:0015631 GO:0016043 GO:0016192 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019220 GO:0019222 GO:0019882 GO:0019884 GO:0019886 GO:0022402 GO:0022607 GO:0030071 GO:0030496 GO:0031323 GO:0031325 GO:0031399 GO:0031401 GO:0031974 GO:0031981 GO:0032268 GO:0032270 GO:0032991 GO:0033043 GO:0033044 GO:0033045 GO:0033047 GO:0033674 GO:0034508 GO:0034622 GO:0042325 GO:0042327 GO:0043085 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043515 GO:0043549 GO:0043933 GO:0044085 GO:0044093 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044430 GO:0044444 GO:0044446 GO:0044464 GO:0044877 GO:0045859 GO:0045860 GO:0045937 GO:0048002 GO:0048193 GO:0048285 GO:0048518 GO:0048522 GO:0050000 GO:0050789 GO:0050790 GO:0050794 GO:0051128 GO:0051171 GO:0051173 GO:0051174 GO:0051179 GO:0051233 GO:0051234 GO:0051246 GO:0051247 GO:0051276 GO:0051303 GO:0051305 GO:0051310 GO:0051315 GO:0051338 GO:0051347 GO:0051382 GO:0051383 GO:0051640 GO:0051641 GO:0051649 GO:0051656 GO:0051726 GO:0051783 GO:0051983 GO:0060255 GO:0065003 GO:0065004 GO:0065007 GO:0065009 GO:0070013 GO:0070925 GO:0071824 GO:0071840 GO:0072686 GO:0080090 GO:0098687 GO:0098813 GO:0099080 GO:0099081 GO:0099512 GO:0099513 GO:0099606 GO:0099607 GO:0140014 GO:1901987 GO:1901990 GO:1902099 GO:1902850 GO:1903047 GO:1905818 GO:1990023

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kinesin

Protein Analysis

91

Amino Acids

11.0

Weight (kDa)

5.5

Isoelectric Point (pI)

59.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002818)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G10180 AT3G10180
fragaria_vesca	FvH4_2g14360 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901 FvH4_7g02901
malus_domestica	MD12G1093000.v1.1 MD12G1093100.v1.1 MD14G1085100.v1.1 MD16G1213600.v1.1
prunus_persica	Prupe.7G041000_v2.0.a1 Prupe.7G041000_v2.0.a1 Prupe.7G041000_v2.0.a1
pyrus_communis	pycom12g07820 pycom14g07460
rosa_chinensis	RchiOBHm_Chr1g0323861
rosa_laevigata	RLG00000030251 RLG00000030294
rosa_multiflora	Rmu_co8206848.1_g000001 Rmu_sc0001449.1_g000013
rosa_roxburghii	Rroxscaffold_4G00326290
rosa_rugosa	Rorug01G0040400
rosa_samantha	Rh1AG057600 Rh1BG048700 Rh1CG059000 Rh1DG062900
rosa_wichuraiana	Rw0G023120 Rw0G023130 Rw1G004920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	76
AcsI	RAATTY	1 cut(s)	196
AgsI	TTSAA	4 cut(s)	194, 207, 222, 250
AluBI	AGCT	3 cut(s)	16, 152, 182
AluI	AGCT	3 cut(s)	16, 152, 182
ApoI	RAATTY	1 cut(s)	196
AspS9I	GGNCC	1 cut(s)	169
AvaII	GGWCC	1 cut(s)	169
BccI	CCATC	1 cut(s)	160
BciVI	GTATCC	1 cut(s)	28
BfaI	CTAG	1 cut(s)	274
BfuI	GTATCC	1 cut(s)	28
Bme18I	GGWCC	1 cut(s)	169
BmgT120I	GGNCC	1 cut(s)	169
BsaBI	GATNNNNATC	1 cut(s)	234
BsaJI	CCNNGG	1 cut(s)	120
Bse8I	GATNNNNATC	1 cut(s)	234
BseDI	CCNNGG	1 cut(s)	120
BseGI	GGATG	1 cut(s)	235
BseJI	GATNNNNATC	1 cut(s)	234
BseMII	CTCAG	1 cut(s)	87
BseRI	GAGGAG	2 cut(s)	26, 146
Bsp143I	GATC	1 cut(s)	241
BspACI	CCGC	1 cut(s)	76
BspCNI	CTCAG	1 cut(s)	88
BssECI	CCNNGG	1 cut(s)	120
BssMI	GATC	1 cut(s)	241
BssT1I	CCWWGG	1 cut(s)	120
BstDEI	CTNAG	2 cut(s)	96, 183
BstF5I	GGATG	1 cut(s)	235
BstKTI	GATC	1 cut(s)	244
BstMBI	GATC	1 cut(s)	241
BsuI	GTATCC	1 cut(s)	28
BtsCI	GGATG	1 cut(s)	235
Cfr13I	GGNCC	1 cut(s)	169
CviJI	RGCY	5 cut(s)	16, 119, 146, 152, 182
CviKI_1	RGCY	5 cut(s)	16, 119, 146, 152, 182
DdeI	CTNAG	2 cut(s)	96, 183
DpnI	GATC	1 cut(s)	243
DpnII	GATC	1 cut(s)	241
Eco130I	CCWWGG	1 cut(s)	120
Eco47I	GGWCC	1 cut(s)	169
EcoT14I	CCWWGG	1 cut(s)	120
ErhI	CCWWGG	1 cut(s)	120
FaiI	YATR	1 cut(s)	116
FokI	GGATG	1 cut(s)	242
FspBI	CTAG	1 cut(s)	274
HinfI	GANTC	1 cut(s)	235
Hpy188I	TCNGA	1 cut(s)	46
Hpy188III	TCNNGA	2 cut(s)	239, 250
HpyAV	CCTTC	1 cut(s)	247
HpyCH4V	TGCA	2 cut(s)	31, 91
HpyF3I	CTNAG	2 cut(s)	96, 183
Kzo9I	GATC	1 cut(s)	241
LmnI	GCTCC	2 cut(s)	13, 109
LpnPI	CCDG	1 cut(s)	17
MaeI	CTAG	1 cut(s)	274
MalI	GATC	1 cut(s)	243
MboI	GATC	1 cut(s)	241
MboII	GAAGA	1 cut(s)	175
MluCI	AATT	5 cut(s)	6, 26, 70, 189, 196
MmeI	TCCRAC	2 cut(s)	108, 196
MnlI	CCTC	5 cut(s)	4, 52, 77, 124, 127
NdeII	GATC	1 cut(s)	241
PfeI	GAWTC	1 cut(s)	235
PspPI	GGNCC	1 cut(s)	169
Sau3AI	GATC	1 cut(s)	241
Sau96I	GGNCC	1 cut(s)	169
SetI	ASST	4 cut(s)	18, 154, 184, 258
SgeI	CNNG	7 cut(s)	32, 44, 133, 161, 191, 251, 262
SinI	GGWCC	1 cut(s)	169
Sse9I	AATT	5 cut(s)	6, 26, 70, 189, 196
SsiI	CCGC	1 cut(s)	76
SspMI	CTAG	1 cut(s)	274
StyI	CCWWGG	1 cut(s)	120
TaqI	TCGA	1 cut(s)	19
TasI	AATT	5 cut(s)	6, 26, 70, 189, 196
TfiI	GAWTC	1 cut(s)	235
VpaK11BI	GGWCC	1 cut(s)	169
XapI	RAATTY	1 cut(s)	196
XspI	CTAG	1 cut(s)	274

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.