Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8207494.1

Orthogroup ID

OG0010892

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 703

Gene Structure 702 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8207494.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 502 bp

atgaccatgttaagaagctcctctatctcctccccatcacttgactctctcattcctcgccaacccaacagtgtcaatcccaccaggaatctcatctccctcaccaaatcacctcttcccctgactctcaaatactcaatctccatgaacaatcaaaatctccgcaccgtttgtagctccaaatcagacaatggatcccatgacccttcttcttctcagggaggtgaatcattcttcaggggagtgttggcaaacatggaggctgtgtacttgagcaggaaccctacagcaaagtcagtgttggagcttgttgggtccgatgaacagattagctatgatcattttgcattcaggacctttggggtgaatggttatgggattgattccatggctagatttttcttggatttcgggtacactccccgggaggagttacgattcccggctaagaaattgagggcattctggtttgctcctcctagttataccatttctgatggtg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1338

Protein Analysis

167

Amino Acids

18.53

Weight (kDa)

9.13

Isoelectric Point (pI)

43.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010892)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G07040
fragaria_vesca	FvH4_4g31940 FvH4_4g31940 FvH4_4g31940 FvH4_4g31940
malus_domestica	MD16G1078500.v1.1
prunus_persica	Prupe.1G268000_v2.0.a1 Prupe.1G268000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0440591
rosa_laevigata	RLG00000006165
rosa_multiflora	Rmu_co8207494.1_g000001 Rmu_sc0008018.1_g000003
rosa_roxburghii	Rroxscaffold_5G00381420
rosa_rugosa	Rorug04G0326900
rosa_samantha	Rh4AG378800 Rh4BG391400 Rh4CG406100 Rh4DG385300
rosa_wichuraiana	Rw4G032530 Rw4G032570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	163
AclWI	GGATC	2 cut(s)	189, 202
AcuI	CTGAAG	1 cut(s)	220
AfaI	GTAC	2 cut(s)	269, 416
AjnI	CCWGG	1 cut(s)	83
AluBI	AGCT	4 cut(s)	18, 177, 307, 333
AluI	AGCT	4 cut(s)	18, 177, 307, 333
AlwI	GGATC	2 cut(s)	189, 202
Ama87I	CYCGRG	1 cut(s)	423
AspS9I	GGNCC	2 cut(s)	315, 354
AsuC2I	CCSGG	3 cut(s)	424, 425, 443
AsuHPI	GGTGA	4 cut(s)	94, 102, 236, 376
AvaI	CYCGRG	1 cut(s)	423
AvaII	GGWCC	2 cut(s)	315, 354
BamHI	GGATCC	1 cut(s)	194
BccI	CCATC	2 cut(s)	43, 491
BciT130I	CCWGG	1 cut(s)	85
BclI	TGATCA	1 cut(s)	337
BcnI	CCSGG	3 cut(s)	424, 425, 443
BfaI	CTAG	2 cut(s)	393, 480
BfmI	CTRYAG	1 cut(s)	285
Bme1390I	CCNGG	4 cut(s)	85, 424, 425, 443
Bme18I	GGWCC	2 cut(s)	315, 354
BmeT110I	CYCGRG	1 cut(s)	423
BmgT120I	GGNCC	2 cut(s)	315, 354
BmiI	GGNNCC	3 cut(s)	196, 281, 316
BmrFI	CCNGG	4 cut(s)	85, 424, 425, 443
BpuEI	CTTGAG	1 cut(s)	292
BpuMI	CCSGG	3 cut(s)	424, 425, 443
BsaJI	CCNNGG	3 cut(s)	387, 422, 423
BsaXI	ACNNNNNCTCC	4 cut(s)	125, 155, 251, 281
BseBI	CCWGG	1 cut(s)	85
BseDI	CCNNGG	3 cut(s)	387, 422, 423
BseMII	CTCAG	1 cut(s)	230
BseRI	GAGGAG	4 cut(s)	10, 19, 443, 465
BsiHKCI	CYCGRG	1 cut(s)	423
BsiSI	CCGG	2 cut(s)	424, 443
BsmI	GAATGC	2 cut(s)	347, 461
BsoBI	CYCGRG	1 cut(s)	423
Bsp143I	GATC	2 cut(s)	194, 337
Bsp19I	CCATGG	1 cut(s)	387
BspACI	CCGC	1 cut(s)	163
BspCNI	CTCAG	1 cut(s)	229
BspLI	GGNNCC	3 cut(s)	196, 281, 316
BspPI	GGATC	2 cut(s)	189, 202
BssECI	CCNNGG	3 cut(s)	387, 422, 423
BssMI	GATC	2 cut(s)	194, 337
BssT1I	CCWWGG	1 cut(s)	387
Bst2UI	CCWGG	1 cut(s)	85
Bst4CI	ACNGT	2 cut(s)	71, 169
Bst6I	CTCTTC	1 cut(s)	120
BstDEI	CTNAG	2 cut(s)	216, 447
BstDSI	CCRYGG	1 cut(s)	387
BstKTI	GATC	2 cut(s)	197, 340
BstMBI	GATC	2 cut(s)	194, 337
BstNI	CCWGG	1 cut(s)	85
BstSCI	CCNGG	4 cut(s)	83, 422, 423, 441
BstSFI	CTRYAG	1 cut(s)	285
BstX2I	RGATCY	1 cut(s)	194
BstYI	RGATCY	1 cut(s)	194
BtgI	CCRYGG	1 cut(s)	387
BtsIMutI	CAGTG	2 cut(s)	76, 303
Cfr13I	GGNCC	2 cut(s)	315, 354
Cfr9I	CCCGGG	1 cut(s)	423
Csp6I	GTAC	2 cut(s)	268, 415
CviAII	CATG	5 cut(s)	7, 145, 200, 256, 388
CviJI	RGCY	7 cut(s)	18, 177, 263, 307, 333, 392, 446
CviKI_1	RGCY	7 cut(s)	18, 177, 263, 307, 333, 392, 446
CviQI	GTAC	2 cut(s)	268, 415
DdeI	CTNAG	2 cut(s)	216, 447
DpnI	GATC	2 cut(s)	196, 339
DpnII	GATC	2 cut(s)	194, 337
Eam1104I	CTCTTC	1 cut(s)	120
EarI	CTCTTC	1 cut(s)	120
Eco130I	CCWWGG	1 cut(s)	387
Eco47I	GGWCC	2 cut(s)	315, 354
Eco57I	CTGAAG	1 cut(s)	220
Eco88I	CYCGRG	1 cut(s)	423
EcoO109I	RGGNCCY	1 cut(s)	354
EcoRII	CCWGG	1 cut(s)	83
EcoT14I	CCWWGG	1 cut(s)	387
ErhI	CCWWGG	1 cut(s)	387
FaeI	CATG	5 cut(s)	10, 148, 203, 259, 391
FaiI	YATR	8 cut(s)	8, 146, 201, 257, 336, 375, 389, 486
FatI	CATG	5 cut(s)	6, 144, 199, 255, 387
FbaI	TGATCA	1 cut(s)	337
FspBI	CTAG	2 cut(s)	393, 480
HapII	CCGG	2 cut(s)	424, 443
Hin1II	CATG	5 cut(s)	10, 148, 203, 259, 391
HinfI	GANTC	6 cut(s)	44, 88, 124, 227, 383, 438
HpaII	CCGG	2 cut(s)	424, 443
HphI	GGTGA	4 cut(s)	94, 102, 236, 376
Hpy166II	GTNNAC	2 cut(s)	268, 417
Hpy188I	TCNGA	3 cut(s)	187, 319, 496
Hpy188III	TCNNGA	1 cut(s)	352
Hpy8I	GTNNAC	2 cut(s)	268, 417
HpyAV	CCTTC	1 cut(s)	216
HpyCH4III	ACNGT	2 cut(s)	71, 169
HpyCH4V	TGCA	1 cut(s)	347
HpyF3I	CTNAG	2 cut(s)	216, 447
Hsp92II	CATG	5 cut(s)	10, 148, 203, 259, 391
Ksp22I	TGATCA	1 cut(s)	337
Kzo9I	GATC	2 cut(s)	194, 337
LmnI	GCTCC	4 cut(s)	23, 182, 304, 478
MaeI	CTAG	2 cut(s)	393, 480
MaeIII	GTNAC	1 cut(s)	432
MalI	GATC	2 cut(s)	196, 339
MboI	GATC	2 cut(s)	194, 337
MboII	GAAGA	4 cut(s)	107, 201, 204, 226
MflI	RGATCY	1 cut(s)	194
MluCI	AATT	1 cut(s)	452
MlyI	GAGTC	2 cut(s)	38, 118
MmeI	TCCRAC	1 cut(s)	282
MseI	TTAA	1 cut(s)	11
MspI	CCGG	2 cut(s)	424, 443
MspR9I	CCNGG	4 cut(s)	85, 424, 425, 443
Mva1269I	GAATGC	2 cut(s)	347, 461
MvaI	CCWGG	1 cut(s)	85
NciI	CCSGG	3 cut(s)	424, 425, 443
NcoI	CCATGG	1 cut(s)	387
NdeII	GATC	2 cut(s)	194, 337
NlaIII	CATG	5 cut(s)	10, 148, 203, 259, 391
NlaIV	GGNNCC	3 cut(s)	196, 281, 316
PctI	GAATGC	2 cut(s)	347, 461
PfeI	GAWTC	4 cut(s)	88, 227, 383, 438
PleI	GAGTC	2 cut(s)	38, 118
PpsI	GAGTC	2 cut(s)	38, 118
PpuMI	RGGWCCY	1 cut(s)	354
Psp5II	RGGWCCY	1 cut(s)	354
Psp6I	CCWGG	1 cut(s)	83
PspGI	CCWGG	1 cut(s)	83
PspN4I	GGNNCC	3 cut(s)	196, 281, 316
PspPI	GGNCC	2 cut(s)	315, 354
PspPPI	RGGWCCY	1 cut(s)	354
PsuI	RGATCY	1 cut(s)	194
RsaI	GTAC	2 cut(s)	269, 416
RsaNI	GTAC	2 cut(s)	268, 415
SaqAI	TTAA	1 cut(s)	11
Sau3AI	GATC	2 cut(s)	194, 337
Sau96I	GGNCC	2 cut(s)	315, 354
SchI	GAGTC	2 cut(s)	38, 118
ScrFI	CCNGG	4 cut(s)	85, 424, 425, 443
SetI	ASST	7 cut(s)	20, 115, 179, 226, 309, 335, 359
SfcI	CTRYAG	1 cut(s)	285
SinI	GGWCC	2 cut(s)	315, 354
SmaI	CCCGGG	1 cut(s)	425
SmlI	CTYRAG	1 cut(s)	271
SmoI	CTYRAG	1 cut(s)	271
Sse9I	AATT	1 cut(s)	452
SsiI	CCGC	1 cut(s)	163
SspMI	CTAG	2 cut(s)	393, 480
StyD4I	CCNGG	4 cut(s)	83, 422, 423, 441
StyI	CCWWGG	1 cut(s)	387
TaaI	ACNGT	2 cut(s)	71, 169
TasI	AATT	1 cut(s)	452
TatI	WGTACW	1 cut(s)	267
TfiI	GAWTC	4 cut(s)	88, 227, 383, 438
Tru1I	TTAA	1 cut(s)	11
Tru9I	TTAA	1 cut(s)	11
TscAI	CASTG	2 cut(s)	76, 303
TspDTI	ATGAA	2 cut(s)	161, 336
TspMI	CCCGGG	1 cut(s)	423
TspRI	CASTG	2 cut(s)	76, 303
VpaK11BI	GGWCC	2 cut(s)	315, 354
XmaI	CCCGGG	1 cut(s)	423
XspI	CTAG	2 cut(s)	393, 480

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.