Rmu_co8238379.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8238379.1
Physical Location & Seq
Reverse (-)
2 .. 336
335 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8238379.1_g000001.1.cds

Sequence Viewer

Length: 335 bp
atgccatcgtttacgaagcacatcttctccacaatttccaaccctattggccattcatctcaggcctccatttctgctagctcgttgattaaactacgtcgttttagctccggtactgatcgtggccgtgaaatggaagcgccggagaaacaaccgccggagccgatacccaataggcccttaagagggcagagaccatcgaatccccggaccaatgctgatagaaggagagagagccatcccaatttagaaaggaggagggagaaccctaatccgccattgcaggacagcagttttcttgagaagctcaagatgggtcttgacaagtcgaagag

Protein Analysis

111

Amino Acids

12.61

Weight (kDa)

11.09

Isoelectric Point (pI)

75.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012429)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 155, 275
AcoI YGGCCR 2 cut(s) 49, 124
AfaI GTAC 1 cut(s) 115
AfiI CCNNNNNNNGG 3 cut(s) 133, 185, 186
AflII CTTAAG 1 cut(s) 181
AluBI AGCT 3 cut(s) 81, 108, 307
AluI AGCT 3 cut(s) 81, 108, 307
Alw26I GTCTC 1 cut(s) 187
AoxI GGCC 4 cut(s) 49, 63, 124, 176
AspLEI GCGC 1 cut(s) 142
AspS9I GGNCC 2 cut(s) 177, 210
AsuC2I CCSGG 1 cut(s) 208
AsuNHI GCTAGC 1 cut(s) 77
AvaII GGWCC 1 cut(s) 210
BalI TGGCCA 1 cut(s) 51
BccI CCATC 4 cut(s) 13, 205, 246, 307
BceAI ACGGC 1 cut(s) 111
BcnI CCSGG 1 cut(s) 208
BcoDI GTCTC 1 cut(s) 187
BfaI CTAG 1 cut(s) 78
BfoI RGCGCY 1 cut(s) 143
BfrI CTTAAG 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 208
Bme18I GGWCC 1 cut(s) 210
BmgT120I GGNCC 2 cut(s) 177, 210
BmiI GGNNCC 1 cut(s) 162
BmrFI CCNGG 1 cut(s) 208
BmtI GCTAGC 1 cut(s) 81
BpuEI CTTGAG 2 cut(s) 293, 320
BpuMI CCSGG 1 cut(s) 208
BsaI GGTCTC 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 206
BsaWI WCCGGW 1 cut(s) 110
BsaXI ACNNNNNCTCC 2 cut(s) 11, 41
Bsc4I CCNNNNNNNGG 3 cut(s) 133, 185, 186
Bse3DI GCAATG 1 cut(s) 278
BseDI CCNNGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 238
BseLI CCNNNNNNNGG 3 cut(s) 133, 185, 186
BseMI GCAATG 1 cut(s) 278
BseMII CTCAG 1 cut(s) 74
BseRI GAGGAG 1 cut(s) 271
BshFI GGCC 4 cut(s) 51, 65, 126, 178
BsiSI CCGG 4 cut(s) 111, 143, 158, 208
BslI CCNNNNNNNGG 3 cut(s) 133, 185, 186
BsmAI GTCTC 1 cut(s) 187
BsnI GGCC 4 cut(s) 51, 65, 126, 178
Bso31I GGTCTC 1 cut(s) 187
Bsp143I GATC 1 cut(s) 118
BspACI CCGC 2 cut(s) 155, 275
BspANI GGCC 4 cut(s) 51, 65, 126, 178
BspCNI CTCAG 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 162
BspOI GCTAGC 1 cut(s) 81
BspTI CTTAAG 1 cut(s) 181
BspTNI GGTCTC 1 cut(s) 187
BsrDI GCAATG 1 cut(s) 278
BssECI CCNNGG 1 cut(s) 206
BssMI GATC 1 cut(s) 118
Bst6I CTCTTC 1 cut(s) 326
BstAFI CTTAAG 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 238
BstH2I RGCGCY 1 cut(s) 143
BstHHI GCGC 1 cut(s) 142
BstKTI GATC 1 cut(s) 121
BstMAI GTCTC 1 cut(s) 187
BstMBI GATC 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 206
BsuRI GGCC 4 cut(s) 51, 65, 126, 178
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 1 cut(s) 79
CfoI GCGC 1 cut(s) 142
Cfr13I GGNCC 2 cut(s) 177, 210
Csp6I GTAC 1 cut(s) 114
CviJI RGCY 9 cut(s) 51, 65, 81, 108, 126, 163, 178, 237, 307
CviKI_1 RGCY 9 cut(s) 51, 65, 81, 108, 126, 163, 178, 237, 307
CviQI GTAC 1 cut(s) 114
DdeI CTNAG 1 cut(s) 60
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
EaeI YGGCCR 2 cut(s) 49, 124
Eam1104I CTCTTC 1 cut(s) 326
EarI CTCTTC 1 cut(s) 326
EciI GGCGGA 1 cut(s) 264
Eco147I AGGCCT 1 cut(s) 65
Eco31I GGTCTC 1 cut(s) 187
Eco47I GGWCC 1 cut(s) 210
EcoO109I RGGNCCY 1 cut(s) 177
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FokI GGATG 1 cut(s) 225
FspBI CTAG 1 cut(s) 78
GlaI GCGC 1 cut(s) 141
HaeII RGCGCY 1 cut(s) 143
HaeIII GGCC 4 cut(s) 51, 65, 126, 178
HapII CCGG 4 cut(s) 111, 143, 158, 208
HhaI GCGC 1 cut(s) 142
Hin6I GCGC 1 cut(s) 140
HinP1I GCGC 1 cut(s) 140
HinfI GANTC 1 cut(s) 202
HpaII CCGG 4 cut(s) 111, 143, 158, 208
Hpy166II GTNNAC 1 cut(s) 12
Hpy188III TCNNGA 3 cut(s) 299, 310, 320
Hpy8I GTNNAC 1 cut(s) 12
Hpy99I CGWCG 1 cut(s) 102
HpyAV CCTTC 1 cut(s) 219
HpyCH4IV ACGT 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 283
HpyF3I CTNAG 1 cut(s) 60
HpySE526I ACGT 1 cut(s) 97
HspAI GCGC 1 cut(s) 140
Kzo9I GATC 1 cut(s) 118
LmnI GCTCC 2 cut(s) 113, 160
LpnPI CCDG 6 cut(s) 47, 124, 156, 171, 221, 269
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 97
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MboII GAAGA 1 cut(s) 16
MlsI TGGCCA 1 cut(s) 51
MluCI AATT 2 cut(s) 33, 244
MluNI TGGCCA 1 cut(s) 51
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 4 cut(s) 76, 179, 249, 252
Mox20I TGGCCA 1 cut(s) 51
MscI TGGCCA 1 cut(s) 51
MseI TTAA 2 cut(s) 90, 182
Msp20I TGGCCA 1 cut(s) 51
MspCI CTTAAG 1 cut(s) 181
MspI CCGG 4 cut(s) 111, 143, 158, 208
MspR9I CCNGG 1 cut(s) 208
NciI CCSGG 1 cut(s) 208
NdeII GATC 1 cut(s) 118
NheI GCTAGC 1 cut(s) 77
NlaIV GGNNCC 1 cut(s) 162
PceI AGGCCT 1 cut(s) 65
PfeI GAWTC 1 cut(s) 202
PspN4I GGNNCC 1 cut(s) 162
PspPI GGNCC 2 cut(s) 177, 210
RsaI GTAC 1 cut(s) 115
RsaNI GTAC 1 cut(s) 114
SaqAI TTAA 2 cut(s) 90, 182
Sau3AI GATC 1 cut(s) 118
Sau96I GGNCC 2 cut(s) 177, 210
ScrFI CCNGG 1 cut(s) 208
SetI ASST 4 cut(s) 83, 100, 110, 309
SinI GGWCC 1 cut(s) 210
SmlI CTYRAG 3 cut(s) 181, 299, 308
SmoI CTYRAG 3 cut(s) 181, 299, 308
Sse9I AATT 2 cut(s) 33, 244
SseBI AGGCCT 1 cut(s) 65
SsiI CCGC 2 cut(s) 155, 275
SspMI CTAG 1 cut(s) 78
StuI AGGCCT 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 206
TaiI ACGT 1 cut(s) 100
TaqI TCGA 2 cut(s) 200, 329
TasI AATT 2 cut(s) 33, 244
TfiI GAWTC 1 cut(s) 202
Tru1I TTAA 2 cut(s) 90, 182
Tru9I TTAA 2 cut(s) 90, 182
TspDTI ATGAA 1 cut(s) 45
Vha464I CTTAAG 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 210
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.