Rmu_co8249465.1_g000001

Violaxanthin

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8249465.1
Physical Location & Seq
Forward (+)
1 .. 310
310 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8249465.1_g000001.1.cds

Sequence Viewer

Length: 310 bp
ttggacaatcgtggatgtagctgatgatcttagttggggtttgttttactactctggcgctgcaagagttgctggacaatcttatactggcgctgtgcttgtcagtccagatgcggcacacccaaatgacgtgcataggagcagattagtttccgcattggagaactgtggaattaaagagtggaagctgtttacagttaacaattcttcgtgtgctaatcctccattggggattcctgagggttcaagtttgcattccgtgatagaagttaaagatcagaaatctttgtcggatttggcagaggtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

10.94

Weight (kDa)

4.9

Isoelectric Point (pI)

27.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 114, 154
AfiI CCNNNNNNNGG 1 cut(s) 228
AgsI TTSAA 1 cut(s) 247
AjiI CACGTC 1 cut(s) 131
AluBI AGCT 2 cut(s) 21, 188
AluI AGCT 2 cut(s) 21, 188
ApeKI GCWGC 1 cut(s) 60
AspLEI GCGC 2 cut(s) 60, 93
AxyI CCTNAGG 1 cut(s) 238
BbvI GCAGC 1 cut(s) 47
BfoI RGCGCY 2 cut(s) 61, 94
BisI GCNGC 2 cut(s) 61, 115
BlsI GCNGC 2 cut(s) 62, 116
BmgBI CACGTC 1 cut(s) 131
BmsI GCATC 1 cut(s) 101
Bsc4I CCNNNNNNNGG 1 cut(s) 228
Bse1I ACTGG 1 cut(s) 92
Bse21I CCTNAGG 1 cut(s) 238
BseGI GGATG 1 cut(s) 20
BseLI CCNNNNNNNGG 1 cut(s) 228
BseMII CTCAG 1 cut(s) 229
BseNI ACTGG 1 cut(s) 92
BseXI GCAGC 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 228
BsmI GAATGC 1 cut(s) 254
Bsp143I GATC 2 cut(s) 26, 275
BspACI CCGC 2 cut(s) 114, 154
BspCNI CTCAG 1 cut(s) 230
BsrI ACTGG 1 cut(s) 92
BssMI GATC 2 cut(s) 26, 275
Bst4CI ACNGT 2 cut(s) 168, 197
BstAPI GCANNNNNTGC 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 30, 238
BstF5I GGATG 1 cut(s) 20
BstH2I RGCGCY 2 cut(s) 61, 94
BstHHI GCGC 2 cut(s) 60, 93
BstKTI GATC 2 cut(s) 29, 278
BstMBI GATC 2 cut(s) 26, 275
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstV1I GCAGC 1 cut(s) 47
Bsu36I CCTNAGG 1 cut(s) 238
BtrI CACGTC 1 cut(s) 131
BtsCI GGATG 1 cut(s) 20
CfoI GCGC 2 cut(s) 60, 93
CviJI RGCY 2 cut(s) 21, 188
CviKI_1 RGCY 2 cut(s) 21, 188
DdeI CTNAG 2 cut(s) 30, 238
DpnI GATC 2 cut(s) 28, 277
DpnII GATC 2 cut(s) 26, 275
Eco81I CCTNAGG 1 cut(s) 238
FaiI YATR 2 cut(s) 85, 136
Fnu4HI GCNGC 2 cut(s) 61, 115
FokI GGATG 1 cut(s) 27
Fsp4HI GCNGC 2 cut(s) 61, 115
GlaI GCGC 2 cut(s) 59, 92
GluI GCNGC 2 cut(s) 61, 115
HaeII RGCGCY 2 cut(s) 61, 94
HhaI GCGC 2 cut(s) 60, 93
Hin6I GCGC 2 cut(s) 58, 91
HinP1I GCGC 2 cut(s) 58, 91
HincII GTYRAC 1 cut(s) 200
HindII GTYRAC 1 cut(s) 200
HinfI GANTC 1 cut(s) 233
HpaI GTTAAC 1 cut(s) 200
Hpy166II GTNNAC 2 cut(s) 193, 200
Hpy188I TCNGA 2 cut(s) 280, 293
Hpy188III TCNNGA 2 cut(s) 108, 237
Hpy8I GTNNAC 2 cut(s) 193, 200
HpyCH4III ACNGT 2 cut(s) 168, 197
HpyCH4IV ACGT 1 cut(s) 130
HpyCH4V TGCA 3 cut(s) 63, 134, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
HpyF3I CTNAG 2 cut(s) 30, 238
HpySE526I ACGT 1 cut(s) 130
HspAI GCGC 2 cut(s) 58, 91
KspAI GTTAAC 1 cut(s) 200
Kzo9I GATC 2 cut(s) 26, 275
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 5 cut(s) 40, 58, 73, 121, 250
Lsp1109I GCAGC 1 cut(s) 47
LweI GCATC 1 cut(s) 101
MaeII ACGT 1 cut(s) 130
MalI GATC 2 cut(s) 28, 277
MboI GATC 2 cut(s) 26, 275
MboII GAAGA 1 cut(s) 199
MluCI AATT 2 cut(s) 172, 203
MmeI TCCRAC 1 cut(s) 271
MnlI CCTC 3 cut(s) 232, 233, 296
MseI TTAA 3 cut(s) 175, 199, 271
MslI CAYNNNNRTG 1 cut(s) 124
Mva1269I GAATGC 1 cut(s) 254
MwoI GCNNNNNNNGC 1 cut(s) 69
NdeII GATC 2 cut(s) 26, 275
PctI GAATGC 1 cut(s) 254
PfeI GAWTC 1 cut(s) 233
PkrI GCNGC 2 cut(s) 62, 116
RseI CAYNNNNRTG 1 cut(s) 124
SaqAI TTAA 3 cut(s) 175, 199, 271
SatI GCNGC 2 cut(s) 61, 115
Sau3AI GATC 2 cut(s) 26, 275
SetI ASST 4 cut(s) 23, 133, 190, 307
SfaNI GCATC 1 cut(s) 101
SmiMI CAYNNNNRTG 1 cut(s) 124
Sse9I AATT 2 cut(s) 172, 203
SsiI CCGC 2 cut(s) 114, 154
TaaI ACNGT 2 cut(s) 168, 197
TaiI ACGT 1 cut(s) 133
TasI AATT 2 cut(s) 172, 203
TauI GCSGC 1 cut(s) 117
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 3 cut(s) 175, 199, 271
Tru9I TTAA 3 cut(s) 175, 199, 271
TseI GCWGC 1 cut(s) 60
TspGWI ACGGA 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.