Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8258539.1

Orthogroup ID

OG0004566

Physical Location & Seq

Genomic Coordinates Forward (+)

28 .. 804

Gene Structure 777 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8258539.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 695 bp

atgtggaggagcttccaagctcttggtgacatagcttttgcctactcttactctcttattttgattgaaattcaggacacagttagatctccaccatctgaagccaagacaatgaagaaggccactataattagtgttgcagtgacaacccttttctacatgctatgtggctgcatgggctatgctgcttttggagacttatcccctggaaacttgctcactggttttggcttctataacccatattggctcttagacattgccaacgttgctatagtagtccaccttgttggtgcataccaagtttactgccaacccttatttgcctttgttgagaaagcagcagcgaaaaagtatccggagagcgaatttatctcaagagaaatcaaaatcccaattcccggtcttggccattgcaatcttaacctcttcagattggtgtggaggactgcctttgtgattgtgaccactgtaatctctatgctcctcccattctttaatgatgtggttggacttcttggagctttgggattctggccattgactgtttacttcccagttgagatgtacattgtgcagaagaggataccaaagtggagcacaagatggctttgcctccaaatcctaagtgttgcttgccttataataaccatagctgctgctgctggctcaattgctggggtgatttctgacct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003333 GO:0003674 GO:0005215 GO:0005342 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006820 GO:0006865 GO:0008150 GO:0008509 GO:0008514 GO:0015075 GO:0015171 GO:0015174 GO:0015318 GO:0015711 GO:0015802 GO:0015809 GO:0015849 GO:0016020 GO:0022857 GO:0034220 GO:0044464 GO:0046942 GO:0046943 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0071944 GO:0098656 GO:1903825 GO:1905039 GO:1990822

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

232

Amino Acids

25.73

Weight (kDa)

8.5

Isoelectric Point (pI)

44.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004566)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G44100 AT1G77380
fragaria_vesca	FvH4_2g27662 FvH4_2g27662 FvH4_2g27662 FvH4_2g27662
rosa_chinensis	RchiOBHm_Chr5g0038211 RchiOBHm_Chr5g0038231 RchiOBHm_Chr6g0296521
rosa_laevigata	RLG00000011685 RLG00000033839
rosa_multiflora	Rmu_co8258539.1_g000001 Rmu_sc0004318.1_g000008 Rmu_sc0006174.1_g000010 Rmu_sc0012148.1_g000005 Rmu_sc0015248.1_g000006
rosa_roxburghii	Rroxscaffold_7G00171470 Rroxscaffold_7G00178660
rosa_rugosa	Rorug05G0171300 Rorug06G0262900 Rorug06G0262900 Rorug06G0262900
rosa_samantha	Rh2CG368900 Rh5BG262300 Rh5DG271400 Rh6AG374500 Rh6BG382900 Rh6CG387900 Rh6DG375600
rosa_wichuraiana	Rw5G024220 Rw6G032650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	644
AccIII	TCCGGA	1 cut(s)	358
AclI	AACGTT	1 cut(s)	267
AcoI	YGGCCR	2 cut(s)	409, 536
AcsI	RAATTY	2 cut(s)	69, 368
AcuI	CTGAAG	2 cut(s)	120, 415
AfaI	GTAC	1 cut(s)	569
AfiI	CCNNNNNNNGG	2 cut(s)	401, 407
AgsI	TTSAA	1 cut(s)	68
AjnI	CCWGG	1 cut(s)	205
AluBI	AGCT	5 cut(s)	12, 20, 35, 524, 656
AluI	AGCT	5 cut(s)	12, 20, 35, 524, 656
Alw21I	GWGCWC	1 cut(s)	602
Alw26I	GTCTC	1 cut(s)	189
Aor13HI	TCCGGA	1 cut(s)	358
AoxI	GGCC	3 cut(s)	120, 409, 536
ApeKI	GCWGC	7 cut(s)	171, 185, 341, 344, 656, 659, 662
ApoI	RAATTY	2 cut(s)	69, 368
ArsI	GACNNNNNNTTYG	2 cut(s)	20, 52
AsuC2I	CCSGG	1 cut(s)	402
AsuHPI	GGTGA	2 cut(s)	38, 694
BaeI	ACNNNNGTAYC	2 cut(s)	578, 611
BalI	TGGCCA	2 cut(s)	411, 538
Bbv12I	GWGCWC	1 cut(s)	602
BbvI	GCAGC	7 cut(s)	158, 172, 353, 356, 643, 646, 649
BccI	CCATC	2 cut(s)	103, 600
BciT130I	CCWGG	1 cut(s)	207
BciVI	GTATCC	2 cut(s)	366, 579
BcnI	CCSGG	1 cut(s)	402
BcoDI	GTCTC	1 cut(s)	189
BfmI	CTRYAG	1 cut(s)	273
BfuI	GTATCC	2 cut(s)	366, 579
BglII	AGATCT	1 cut(s)	86
BisI	GCNGC	7 cut(s)	172, 186, 342, 345, 657, 660, 663
BlsI	GCNGC	7 cut(s)	173, 187, 343, 346, 658, 661, 664
Bme1390I	CCNGG	2 cut(s)	207, 402
BmrFI	CCNGG	2 cut(s)	207, 402
BmrI	ACTGGG	1 cut(s)	551
BmuI	ACTGGG	1 cut(s)	551
BpuEI	CTTGAG	1 cut(s)	361
BpuMI	CCSGG	1 cut(s)	402
BsaJI	CCNNGG	1 cut(s)	205
BsaWI	WCCGGW	1 cut(s)	358
Bsc4I	CCNNNNNNNGG	2 cut(s)	401, 407
Bse1I	ACTGG	2 cut(s)	226, 557
Bse3DI	GCAATG	2 cut(s)	258, 412
BseAI	TCCGGA	1 cut(s)	358
BseBI	CCWGG	1 cut(s)	207
BseDI	CCNNGG	1 cut(s)	205
BseLI	CCNNNNNNNGG	2 cut(s)	401, 407
BseMI	GCAATG	2 cut(s)	258, 412
BseNI	ACTGG	2 cut(s)	226, 557
BseRI	GAGGAG	2 cut(s)	22, 476
BseXI	GCAGC	7 cut(s)	158, 172, 353, 356, 643, 646, 649
BseYI	CCCAGC	1 cut(s)	677
BsgI	GTGCAG	1 cut(s)	596
BshFI	GGCC	3 cut(s)	122, 411, 538
BsiHKAI	GWGCWC	1 cut(s)	602
BsiSI	CCGG	2 cut(s)	359, 402
BslI	CCNNNNNNNGG	2 cut(s)	401, 407
BsmAI	GTCTC	1 cut(s)	189
BsnI	GGCC	3 cut(s)	122, 411, 538
Bsp1286I	GDGCHC	1 cut(s)	602
Bsp13I	TCCGGA	1 cut(s)	358
Bsp1407I	TGTACA	1 cut(s)	567
Bsp143I	GATC	1 cut(s)	86
BspANI	GGCC	3 cut(s)	122, 411, 538
BspEI	TCCGGA	1 cut(s)	358
BsrDI	GCAATG	2 cut(s)	258, 412
BsrGI	TGTACA	1 cut(s)	567
BsrI	ACTGG	2 cut(s)	226, 557
BssECI	CCNNGG	1 cut(s)	205
BssMI	GATC	1 cut(s)	86
Bst2UI	CCWGG	1 cut(s)	207
Bst4CI	ACNGT	3 cut(s)	82, 472, 547
Bst6I	CTCTTC	2 cut(s)	434, 575
BstAUI	TGTACA	1 cut(s)	567
BstC8I	GCNNGC	2 cut(s)	637, 667
BstDEI	CTNAG	2 cut(s)	253, 626
BstKTI	GATC	1 cut(s)	89
BstMAI	GTCTC	1 cut(s)	189
BstMBI	GATC	1 cut(s)	86
BstMWI	GCNNNNNNNGC	3 cut(s)	177, 269, 662
BstNI	CCWGG	1 cut(s)	207
BstNSI	RCATGY	1 cut(s)	163
BstSCI	CCNGG	2 cut(s)	205, 400
BstSFI	CTRYAG	1 cut(s)	273
BstV1I	GCAGC	7 cut(s)	158, 172, 353, 356, 643, 646, 649
BstX2I	RGATCY	1 cut(s)	86
BstXI	CCANNNNNNTGG	2 cut(s)	23, 290
BstYI	RGATCY	1 cut(s)	86
BsuI	GTATCC	2 cut(s)	366, 579
BsuRI	GGCC	3 cut(s)	122, 411, 538
BtsI	GCAGTG	1 cut(s)	147
BtsIMutI	CAGTG	3 cut(s)	147, 219, 468
Cac8I	GCNNGC	2 cut(s)	637, 667
Csp6I	GTAC	1 cut(s)	568
CviAII	CATG	2 cut(s)	160, 175
CviQI	GTAC	1 cut(s)	568
DdeI	CTNAG	2 cut(s)	253, 626
DpnI	GATC	1 cut(s)	88
DpnII	GATC	1 cut(s)	86
EaeI	YGGCCR	2 cut(s)	409, 536
Eam1104I	CTCTTC	2 cut(s)	434, 575
EarI	CTCTTC	2 cut(s)	434, 575
Eco57I	CTGAAG	2 cut(s)	120, 415
EcoRII	CCWGG	1 cut(s)	205
FaeI	CATG	2 cut(s)	163, 178
FalI	AAGNNNNNCTT	2 cut(s)	619, 651
FatI	CATG	2 cut(s)	159, 174
Fnu4HI	GCNGC	7 cut(s)	172, 186, 342, 345, 657, 660, 663
Fsp4HI	GCNGC	7 cut(s)	172, 186, 342, 345, 657, 660, 663
GluI	GCNGC	7 cut(s)	172, 186, 342, 345, 657, 660, 663
GsaI	CCCAGC	1 cut(s)	681
HaeIII	GGCC	3 cut(s)	122, 411, 538
HapII	CCGG	2 cut(s)	359, 402
Hin1II	CATG	2 cut(s)	163, 178
HinfI	GANTC	1 cut(s)	531
HpaII	CCGG	2 cut(s)	359, 402
HphI	GGTGA	2 cut(s)	38, 694
Hpy166II	GTNNAC	3 cut(s)	283, 307, 550
Hpy188I	TCNGA	3 cut(s)	100, 434, 691
Hpy188III	TCNNGA	3 cut(s)	74, 359, 378
Hpy8I	GTNNAC	3 cut(s)	283, 307, 550
HpyAV	CCTTC	1 cut(s)	112
HpyCH4III	ACNGT	3 cut(s)	82, 472, 547
HpyCH4IV	ACGT	1 cut(s)	267
HpyCH4V	TGCA	5 cut(s)	140, 174, 296, 417, 577
HpyF10VI	GCNNNNNNNGC	3 cut(s)	177, 269, 662
HpyF3I	CTNAG	2 cut(s)	253, 626
HpySE526I	ACGT	1 cut(s)	267
Hsp92II	CATG	2 cut(s)	163, 178
Kpn2I	TCCGGA	1 cut(s)	358
Kzo9I	GATC	1 cut(s)	86
LmnI	GCTCC	4 cut(s)	9, 489, 521, 597
Lsp1109I	GCAGC	7 cut(s)	158, 172, 353, 356, 643, 646, 649
MaeII	ACGT	1 cut(s)	267
MaeIII	GTNAC	3 cut(s)	26, 142, 463
MalI	GATC	1 cut(s)	88
MboI	GATC	1 cut(s)	86
MboII	GAAGA	3 cut(s)	127, 421, 592
MfeI	CAATTG	1 cut(s)	672
MflI	RGATCY	1 cut(s)	86
MhlI	GDGCHC	1 cut(s)	602
MlsI	TGGCCA	2 cut(s)	411, 538
MluCI	AATT	5 cut(s)	69, 129, 368, 396, 672
MluNI	TGGCCA	2 cut(s)	411, 538
MmeI	TCCRAC	1 cut(s)	490
MnlI	CCTC	5 cut(s)	437, 438, 497, 576, 626
Mox20I	TGGCCA	2 cut(s)	411, 538
MroI	TCCGGA	1 cut(s)	358
MscI	TGGCCA	2 cut(s)	411, 538
MseI	TTAA	2 cut(s)	423, 498
Msp20I	TGGCCA	2 cut(s)	411, 538
MspI	CCGG	2 cut(s)	359, 402
MspR9I	CCNGG	2 cut(s)	207, 402
MunI	CAATTG	1 cut(s)	672
MvaI	CCWGG	1 cut(s)	207
MwoI	GCNNNNNNNGC	3 cut(s)	177, 269, 662
NciI	CCSGG	1 cut(s)	402
NdeII	GATC	1 cut(s)	86
NlaIII	CATG	2 cut(s)	163, 178
NmuCI	GTSAC	3 cut(s)	26, 142, 463
NspI	RCATGY	1 cut(s)	163
PfeI	GAWTC	1 cut(s)	531
PkrI	GCNGC	7 cut(s)	173, 187, 343, 346, 658, 661, 664
PsiI	TTATAA	1 cut(s)	644
Psp1406I	AACGTT	1 cut(s)	267
Psp6I	CCWGG	1 cut(s)	205
PspFI	CCCAGC	1 cut(s)	677
PspGI	CCWGG	1 cut(s)	205
PsuI	RGATCY	1 cut(s)	86
RsaI	GTAC	1 cut(s)	569
RsaNI	GTAC	1 cut(s)	568
SaqAI	TTAA	2 cut(s)	423, 498
SatI	GCNGC	7 cut(s)	172, 186, 342, 345, 657, 660, 663
Sau3AI	GATC	1 cut(s)	86
ScrFI	CCNGG	2 cut(s)	207, 402
SduI	GDGCHC	1 cut(s)	602
SetI	ASST	8 cut(s)	14, 22, 37, 270, 288, 429, 526, 658
SfcI	CTRYAG	1 cut(s)	273
SmlI	CTYRAG	1 cut(s)	376
SmoI	CTYRAG	1 cut(s)	376
Sse9I	AATT	5 cut(s)	69, 129, 368, 396, 672
StyD4I	CCNGG	2 cut(s)	205, 400
TaaI	ACNGT	3 cut(s)	82, 472, 547
TaiI	ACGT	1 cut(s)	270
TasI	AATT	5 cut(s)	69, 129, 368, 396, 672
TatI	WGTACW	1 cut(s)	567
TfiI	GAWTC	1 cut(s)	531
Tru1I	TTAA	2 cut(s)	423, 498
Tru9I	TTAA	2 cut(s)	423, 498
TscAI	CASTG	3 cut(s)	147, 226, 475
TseFI	GTSAC	3 cut(s)	26, 142, 463
TseI	GCWGC	7 cut(s)	171, 185, 341, 344, 656, 659, 662
Tsp45I	GTSAC	3 cut(s)	26, 142, 463
TspDTI	ATGAA	1 cut(s)	128
TspRI	CASTG	3 cut(s)	147, 226, 475
XapI	RAATTY	2 cut(s)	69, 368
XceI	RCATGY	1 cut(s)	163

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.