Rmu_co8267121.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8267121.1
Physical Location & Seq
Forward (+)
145 .. 773
629 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8267121.1_g000001.1.cds

Sequence Viewer

Length: 438 bp
atggctatggctatggctttggctatttctccaacctttggttgcaggccatcaaacggttcaaagatcgtcaaatcgtgctccaatattagtagtgatagcaaaacttacacatcccaaatcggaacggagaagcgatgcttgaggtgcaacaacctctacacagacgaggataactcccctactgcttgctccttccatggccacggagagaagggattatttgcattggctccaccacaccaaggaattgatggagagtggagtgacaggtctggagtaattgtgtatagatggaatgagaagaacaagagaccaaacactggaagtgggaattggaagaaaagatggagctgttgtcaagagtatgatcaggatgccacaccctgtcaaagaggatggcatgtttcctatgatgatggcttcactctatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

16.21

Weight (kDa)

8.11

Isoelectric Point (pI)

58.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014784)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 38, 323
AcoI YGGCCR 1 cut(s) 202
AfiI CCNNNNNNNGG 4 cut(s) 38, 56, 245, 323
AgsI TTSAA 1 cut(s) 63
AjuI GAANNNNNNNTTGG 2 cut(s) 319, 351
AluBI AGCT 1 cut(s) 354
AluI AGCT 1 cut(s) 354
Alw21I GWGCWC 1 cut(s) 83
Alw26I GTCTC 1 cut(s) 307
AoxI GGCC 2 cut(s) 47, 202
BalI TGGCCA 1 cut(s) 204
Bbv12I GWGCWC 1 cut(s) 83
BccI CCATC 6 cut(s) 58, 248, 288, 342, 393, 413
BclI TGATCA 1 cut(s) 370
BcoDI GTCTC 1 cut(s) 307
BmiI GGNNCC 1 cut(s) 234
BmsI GCATC 2 cut(s) 128, 367
BplI GAGNNNNNCTC 2 cut(s) 161, 193
BpmI CTGGAG 1 cut(s) 297
BpuEI CTTGAG 1 cut(s) 163
BsaI GGTCTC 1 cut(s) 307
BsaJI CCNNGG 3 cut(s) 199, 205, 244
BsaXI ACNNNNNCTCC 4 cut(s) 270, 300, 343, 373
Bsc4I CCNNNNNNNGG 4 cut(s) 38, 56, 245, 323
Bse1I ACTGG 1 cut(s) 328
BseDI CCNNGG 3 cut(s) 199, 205, 244
BseGI GGATG 3 cut(s) 113, 382, 404
BseLI CCNNNNNNNGG 4 cut(s) 38, 56, 245, 323
BseNI ACTGG 1 cut(s) 328
BshFI GGCC 2 cut(s) 49, 204
BsiHKAI GWGCWC 1 cut(s) 83
BslI CCNNNNNNNGG 4 cut(s) 38, 56, 245, 323
BsmAI GTCTC 1 cut(s) 307
BsnI GGCC 2 cut(s) 49, 204
Bso31I GGTCTC 1 cut(s) 307
Bsp1286I GDGCHC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 66, 370
Bsp19I CCATGG 1 cut(s) 199
BspANI GGCC 2 cut(s) 49, 204
BspLI GGNNCC 1 cut(s) 234
BspTNI GGTCTC 1 cut(s) 307
BsrI ACTGG 1 cut(s) 328
BssECI CCNNGG 3 cut(s) 199, 205, 244
BssMI GATC 2 cut(s) 66, 370
BssT1I CCWWGG 2 cut(s) 199, 244
Bst4CI ACNGT 1 cut(s) 59
BstC8I GCNNGC 2 cut(s) 47, 190
BstDSI CCRYGG 2 cut(s) 199, 205
BstF5I GGATG 3 cut(s) 113, 382, 404
BstKTI GATC 2 cut(s) 69, 373
BstMAI GTCTC 1 cut(s) 307
BstMBI GATC 2 cut(s) 66, 370
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 407
BsuRI GGCC 2 cut(s) 49, 204
BtgI CCRYGG 2 cut(s) 199, 205
BtgZI GCGATG 1 cut(s) 151
BtsCI GGATG 3 cut(s) 113, 382, 404
BtsIMutI CAGTG 1 cut(s) 321
Cac8I GCNNGC 2 cut(s) 47, 190
CviAII CATG 2 cut(s) 200, 404
CviJI RGCY 9 cut(s) 5, 11, 17, 23, 49, 204, 233, 354, 423
CviKI_1 RGCY 9 cut(s) 5, 11, 17, 23, 49, 204, 233, 354, 423
DpnI GATC 2 cut(s) 68, 372
DpnII GATC 2 cut(s) 66, 370
EaeI YGGCCR 1 cut(s) 202
Eco130I CCWWGG 2 cut(s) 199, 244
Eco31I GGTCTC 1 cut(s) 307
EcoT14I CCWWGG 2 cut(s) 199, 244
ErhI CCWWGG 2 cut(s) 199, 244
FaeI CATG 2 cut(s) 203, 407
FaiI YATR 8 cut(s) 8, 14, 201, 291, 369, 405, 414, 433
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FatI CATG 2 cut(s) 199, 403
FbaI TGATCA 1 cut(s) 370
FokI GGATG 3 cut(s) 100, 389, 411
GsuI CTGGAG 1 cut(s) 297
HaeIII GGCC 2 cut(s) 49, 204
Hin1II CATG 2 cut(s) 203, 407
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 3 cut(s) 276, 362, 374
HpyAV CCTTC 2 cut(s) 205, 208
HpyCH4III ACNGT 1 cut(s) 59
HpyCH4V TGCA 3 cut(s) 45, 150, 227
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
Hsp92II CATG 2 cut(s) 203, 407
Ksp22I TGATCA 1 cut(s) 370
Kzo9I GATC 2 cut(s) 66, 370
LmnI GCTCC 4 cut(s) 86, 197, 238, 351
LpnPI CCDG 6 cut(s) 31, 256, 261, 309, 359, 400
LweI GCATC 2 cut(s) 128, 367
MaeIII GTNAC 1 cut(s) 266
MalI GATC 2 cut(s) 68, 372
MboI GATC 2 cut(s) 66, 370
MboII GAAGA 2 cut(s) 316, 352
MhlI GDGCHC 1 cut(s) 83
MlsI TGGCCA 1 cut(s) 204
MluCI AATT 3 cut(s) 249, 282, 334
MluNI TGGCCA 1 cut(s) 204
MmeI TCCRAC 1 cut(s) 56
MnlI CCTC 4 cut(s) 138, 163, 167, 389
Mox20I TGGCCA 1 cut(s) 204
MscI TGGCCA 1 cut(s) 204
Msp20I TGGCCA 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 147
NcoI CCATGG 1 cut(s) 199
NdeII GATC 2 cut(s) 66, 370
NlaIII CATG 2 cut(s) 203, 407
NlaIV GGNNCC 1 cut(s) 234
NmuCI GTSAC 1 cut(s) 266
NspI RCATGY 1 cut(s) 407
PflMI CCANNNNNTGG 2 cut(s) 38, 323
PspN4I GGNNCC 1 cut(s) 234
Sau3AI GATC 2 cut(s) 66, 370
SduI GDGCHC 1 cut(s) 83
SetI ASST 5 cut(s) 38, 149, 159, 275, 356
SfaNI GCATC 2 cut(s) 128, 367
SmlI CTYRAG 1 cut(s) 142
SmoI CTYRAG 1 cut(s) 142
Sse9I AATT 3 cut(s) 249, 282, 334
SspI AATATT 1 cut(s) 88
StyI CCWWGG 2 cut(s) 199, 244
TaaI ACNGT 1 cut(s) 59
TasI AATT 3 cut(s) 249, 282, 334
TscAI CASTG 1 cut(s) 328
TseFI GTSAC 1 cut(s) 266
Tsp45I GTSAC 1 cut(s) 266
TspGWI ACGGA 2 cut(s) 143, 222
TspRI CASTG 1 cut(s) 328
Van91I CCANNNNNTGG 2 cut(s) 38, 323
XceI RCATGY 1 cut(s) 407
XcmI CCANNNNNNNNNTGG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.