Rw1G000980

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
1459110 .. 1460167
1058 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G000980.1

Sequence Viewer

Length: 447 bp
ATGACGGCTATGGCTATGGCTTTGGCTATTTCTCCAACCTTTGGTTGCAGGCCATCAAACGGTTCAAACATCGTCAAATCGTTCTCCAATATTAGTAGTGATAGCAAAACTTACACATCCCAAATCGGAACGGAGAAGCGATGCTTGAGGTGCAACAACCTCTACACAGACGAGGATAACTCCCCTACTGCTTGCTCCTTCCATGGCCACAGTACTGGAGAGAAGGGATTATTTGCATTGGCTCCACCACACCAAGGAATTGATGGAGAGTGGAGTGACAGGTCTGGAGTAATTGTGTATAGATGGAATGAGAAGAACAAGAGACCAAACACTGGAAGTGGGAATTGGAAGAAAAGATGGAGCTGTTGTCAAGAGTATGATCAGGATGCCATACCCTGTCAAAGAGGATGGCATGTTTCCTATGATGATGGCTTCACTCTATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.54

Weight (kDa)

7.58

Isoelectric Point (pI)

57.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014784)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 41, 332
AcoI YGGCCR 1 cut(s) 205
AfaI GTAC 1 cut(s) 214
AfiI CCNNNNNNNGG 4 cut(s) 41, 59, 254, 332
AgsI TTSAA 1 cut(s) 66
AjuI GAANNNNNNNTTGG 2 cut(s) 328, 360
AluBI AGCT 1 cut(s) 363
AluI AGCT 1 cut(s) 363
Alw26I GTCTC 1 cut(s) 316
AoxI GGCC 2 cut(s) 50, 205
BalI TGGCCA 1 cut(s) 207
BccI CCATC 6 cut(s) 61, 257, 297, 351, 402, 422
BceAI ACGGC 1 cut(s) 21
BclI TGATCA 1 cut(s) 379
BcoDI GTCTC 1 cut(s) 316
BmcAI AGTACT 1 cut(s) 214
BmiI GGNNCC 1 cut(s) 243
BmsI GCATC 2 cut(s) 131, 376
BplI GAGNNNNNCTC 2 cut(s) 164, 196
BpmI CTGGAG 2 cut(s) 237, 306
BpuEI CTTGAG 1 cut(s) 166
BsaI GGTCTC 1 cut(s) 316
BsaJI CCNNGG 2 cut(s) 202, 253
BsaXI ACNNNNNCTCC 4 cut(s) 279, 309, 352, 382
Bsc4I CCNNNNNNNGG 4 cut(s) 41, 59, 254, 332
Bse1I ACTGG 2 cut(s) 220, 337
BseDI CCNNGG 2 cut(s) 202, 253
BseGI GGATG 3 cut(s) 116, 391, 413
BseLI CCNNNNNNNGG 4 cut(s) 41, 59, 254, 332
BseNI ACTGG 2 cut(s) 220, 337
BshFI GGCC 2 cut(s) 52, 207
BslI CCNNNNNNNGG 4 cut(s) 41, 59, 254, 332
BsmAI GTCTC 1 cut(s) 316
BsnI GGCC 2 cut(s) 52, 207
Bso31I GGTCTC 1 cut(s) 316
Bsp143I GATC 1 cut(s) 379
Bsp19I CCATGG 1 cut(s) 202
BspANI GGCC 2 cut(s) 52, 207
BspLI GGNNCC 1 cut(s) 243
BspTNI GGTCTC 1 cut(s) 316
BsrI ACTGG 2 cut(s) 220, 337
BssECI CCNNGG 2 cut(s) 202, 253
BssMI GATC 1 cut(s) 379
BssT1I CCWWGG 2 cut(s) 202, 253
Bst4CI ACNGT 2 cut(s) 62, 212
BstC8I GCNNGC 2 cut(s) 50, 193
BstDSI CCRYGG 1 cut(s) 202
BstF5I GGATG 3 cut(s) 116, 391, 413
BstKTI GATC 1 cut(s) 382
BstMAI GTCTC 1 cut(s) 316
BstMBI GATC 1 cut(s) 379
BstMWI GCNNNNNNNGC 1 cut(s) 150
BstNSI RCATGY 1 cut(s) 416
BstXI CCANNNNNNTGG 1 cut(s) 215
BsuRI GGCC 2 cut(s) 52, 207
BtgI CCRYGG 1 cut(s) 202
BtgZI GCGATG 1 cut(s) 154
BtsCI GGATG 3 cut(s) 116, 391, 413
BtsIMutI CAGTG 1 cut(s) 330
Cac8I GCNNGC 2 cut(s) 50, 193
Csp6I GTAC 1 cut(s) 213
CviAII CATG 2 cut(s) 203, 413
CviJI RGCY 9 cut(s) 8, 14, 20, 26, 52, 207, 242, 363, 432
CviKI_1 RGCY 9 cut(s) 8, 14, 20, 26, 52, 207, 242, 363, 432
CviQI GTAC 1 cut(s) 213
DpnI GATC 1 cut(s) 381
DpnII GATC 1 cut(s) 379
EaeI YGGCCR 1 cut(s) 205
Eco130I CCWWGG 2 cut(s) 202, 253
Eco31I GGTCTC 1 cut(s) 316
EcoT14I CCWWGG 2 cut(s) 202, 253
ErhI CCWWGG 2 cut(s) 202, 253
FaeI CATG 2 cut(s) 206, 416
FaiI YATR 9 cut(s) 11, 17, 204, 300, 378, 392, 414, 423, 442
FalI AAGNNNNNCTT 2 cut(s) 128, 160
FatI CATG 2 cut(s) 202, 412
FbaI TGATCA 1 cut(s) 379
FokI GGATG 3 cut(s) 103, 398, 420
GsuI CTGGAG 2 cut(s) 237, 306
HaeIII GGCC 2 cut(s) 52, 207
Hin1II CATG 2 cut(s) 206, 416
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 3 cut(s) 285, 371, 383
HpyAV CCTTC 2 cut(s) 208, 217
HpyCH4III ACNGT 2 cut(s) 62, 212
HpyCH4V TGCA 3 cut(s) 48, 153, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 150
Hsp92II CATG 2 cut(s) 206, 416
Ksp22I TGATCA 1 cut(s) 379
Kzo9I GATC 1 cut(s) 379
LmnI GCTCC 3 cut(s) 200, 247, 360
LpnPI CCDG 7 cut(s) 34, 201, 265, 270, 318, 368, 409
LweI GCATC 2 cut(s) 131, 376
MaeIII GTNAC 1 cut(s) 275
MalI GATC 1 cut(s) 381
MboI GATC 1 cut(s) 379
MboII GAAGA 2 cut(s) 325, 361
MlsI TGGCCA 1 cut(s) 207
MluCI AATT 3 cut(s) 258, 291, 343
MluNI TGGCCA 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 59
MnlI CCTC 4 cut(s) 141, 166, 170, 398
Mox20I TGGCCA 1 cut(s) 207
MscI TGGCCA 1 cut(s) 207
Msp20I TGGCCA 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 150
NcoI CCATGG 1 cut(s) 202
NdeII GATC 1 cut(s) 379
NlaIII CATG 2 cut(s) 206, 416
NlaIV GGNNCC 1 cut(s) 243
NmuCI GTSAC 1 cut(s) 275
NspI RCATGY 1 cut(s) 416
PflMI CCANNNNNTGG 2 cut(s) 41, 332
PspN4I GGNNCC 1 cut(s) 243
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
Sau3AI GATC 1 cut(s) 379
ScaI AGTACT 1 cut(s) 214
SetI ASST 5 cut(s) 41, 152, 162, 284, 365
SfaNI GCATC 2 cut(s) 131, 376
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
Sse9I AATT 3 cut(s) 258, 291, 343
SspI AATATT 1 cut(s) 91
StyI CCWWGG 2 cut(s) 202, 253
TaaI ACNGT 2 cut(s) 62, 212
TasI AATT 3 cut(s) 258, 291, 343
TatI WGTACW 1 cut(s) 212
TscAI CASTG 1 cut(s) 337
TseFI GTSAC 1 cut(s) 275
Tsp45I GTSAC 1 cut(s) 275
TspGWI ACGGA 1 cut(s) 146
TspRI CASTG 1 cut(s) 337
Van91I CCANNNNNTGG 2 cut(s) 41, 332
XceI RCATGY 1 cut(s) 416
XcmI CCANNNNNNNNNTGG 1 cut(s) 260
ZrmI AGTACT 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.