Rmu_sc0009816.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009816.1
OG0014784
Physical Location & Seq
Forward (+)
16478 .. 17106
629 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009816.1_g000004.1.cds

Sequence Viewer

Length: 444 bp
atggctatggctatggctttggctatttctccaacctttggttgcaggccatcaaacggttcaaagatcgtcaaatcgtgctccaatattagtagtgatagcaaaacttacacatcccaaatcggaacggagaagcgatgcttgaggtgcaacaacctctacacagacgaggataactcccctactgcttgctccttccatggccacggtactggagagaagggattatttgcattggctccaccacaccaaggaattgatggagagtggagtgacaggtctggagtaattgtgtatagatggaatgagaagaacaagagaccaaacactggaagtgggaattggaagaaaagatggagctgttgtcaagagtatgatcaggatgccacaccctgtcaaagaggatggcatgtttcctatgatgatggcttcactctatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.37

Weight (kDa)

8.11

Isoelectric Point (pI)

56.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014784)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g00910
malus_domestica MD02G1313500.v1.1
prunus_persica Prupe.2G012100_v2.0.a1 Prupe.2G012100_v2.0.a1
pyrus_communis pycom02g26300
rosa_chinensis RchiOBHm_Chr1g0315801
rosa_laevigata RLG00000030731
rosa_multiflora Rmu_co8267121.1_g000001 Rmu_sc0009816.1_g000004
rosa_roxburghii Rroxscaffold_4G00331430
rosa_rugosa Rorug01G0005600 Rorug01G0005700
rosa_samantha Rh1AG016600 Rh1BG009000 Rh1CG013900 Rh1DG009700
rosa_wichuraiana Rw1G000980

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 38, 329
AcoI YGGCCR 1 cut(s) 202
AfaI GTAC 1 cut(s) 211
AfiI CCNNNNNNNGG 4 cut(s) 38, 56, 251, 329
AgsI TTSAA 1 cut(s) 63
AjuI GAANNNNNNNTTGG 2 cut(s) 325, 357
AluBI AGCT 1 cut(s) 360
AluI AGCT 1 cut(s) 360
Alw21I GWGCWC 1 cut(s) 83
Alw26I GTCTC 1 cut(s) 313
AoxI GGCC 2 cut(s) 47, 202
BalI TGGCCA 1 cut(s) 204
Bbv12I GWGCWC 1 cut(s) 83
BccI CCATC 6 cut(s) 58, 254, 294, 348, 399, 419
BclI TGATCA 1 cut(s) 376
BcoDI GTCTC 1 cut(s) 313
BmiI GGNNCC 1 cut(s) 240
BmsI GCATC 2 cut(s) 128, 373
BplI GAGNNNNNCTC 2 cut(s) 161, 193
BpmI CTGGAG 2 cut(s) 234, 303
BpuEI CTTGAG 1 cut(s) 163
BsaI GGTCTC 1 cut(s) 313
BsaJI CCNNGG 3 cut(s) 199, 205, 250
BsaXI ACNNNNNCTCC 4 cut(s) 276, 306, 349, 379
Bsc4I CCNNNNNNNGG 4 cut(s) 38, 56, 251, 329
Bse1I ACTGG 2 cut(s) 217, 334
BseDI CCNNGG 3 cut(s) 199, 205, 250
BseGI GGATG 3 cut(s) 113, 388, 410
BseLI CCNNNNNNNGG 4 cut(s) 38, 56, 251, 329
BseNI ACTGG 2 cut(s) 217, 334
BshFI GGCC 2 cut(s) 49, 204
BsiHKAI GWGCWC 1 cut(s) 83
BslI CCNNNNNNNGG 4 cut(s) 38, 56, 251, 329
BsmAI GTCTC 1 cut(s) 313
BsnI GGCC 2 cut(s) 49, 204
Bso31I GGTCTC 1 cut(s) 313
Bsp1286I GDGCHC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 66, 376
Bsp19I CCATGG 1 cut(s) 199
BspANI GGCC 2 cut(s) 49, 204
BspLI GGNNCC 1 cut(s) 240
BspTNI GGTCTC 1 cut(s) 313
BsrI ACTGG 2 cut(s) 217, 334
BssECI CCNNGG 3 cut(s) 199, 205, 250
BssMI GATC 2 cut(s) 66, 376
BssT1I CCWWGG 2 cut(s) 199, 250
Bst4CI ACNGT 2 cut(s) 59, 209
BstC8I GCNNGC 2 cut(s) 47, 190
BstDSI CCRYGG 2 cut(s) 199, 205
BstF5I GGATG 3 cut(s) 113, 388, 410
BstKTI GATC 2 cut(s) 69, 379
BstMAI GTCTC 1 cut(s) 313
BstMBI GATC 2 cut(s) 66, 376
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 413
BstXI CCANNNNNNTGG 1 cut(s) 212
BsuRI GGCC 2 cut(s) 49, 204
BtgI CCRYGG 2 cut(s) 199, 205
BtgZI GCGATG 1 cut(s) 151
BtsCI GGATG 3 cut(s) 113, 388, 410
BtsIMutI CAGTG 1 cut(s) 327
Cac8I GCNNGC 2 cut(s) 47, 190
Csp6I GTAC 1 cut(s) 210
CviAII CATG 2 cut(s) 200, 410
CviJI RGCY 9 cut(s) 5, 11, 17, 23, 49, 204, 239, 360, 429
CviKI_1 RGCY 9 cut(s) 5, 11, 17, 23, 49, 204, 239, 360, 429
CviQI GTAC 1 cut(s) 210
DpnI GATC 2 cut(s) 68, 378
DpnII GATC 2 cut(s) 66, 376
EaeI YGGCCR 1 cut(s) 202
Eco130I CCWWGG 2 cut(s) 199, 250
Eco31I GGTCTC 1 cut(s) 313
EcoT14I CCWWGG 2 cut(s) 199, 250
ErhI CCWWGG 2 cut(s) 199, 250
FaeI CATG 2 cut(s) 203, 413
FaiI YATR 8 cut(s) 8, 14, 201, 297, 375, 411, 420, 439
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FatI CATG 2 cut(s) 199, 409
FbaI TGATCA 1 cut(s) 376
FokI GGATG 3 cut(s) 100, 395, 417
GsuI CTGGAG 2 cut(s) 234, 303
HaeIII GGCC 2 cut(s) 49, 204
Hin1II CATG 2 cut(s) 203, 413
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 3 cut(s) 282, 368, 380
HpyAV CCTTC 2 cut(s) 205, 214
HpyCH4III ACNGT 2 cut(s) 59, 209
HpyCH4V TGCA 3 cut(s) 45, 150, 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
Hsp92II CATG 2 cut(s) 203, 413
Ksp22I TGATCA 1 cut(s) 376
Kzo9I GATC 2 cut(s) 66, 376
LmnI GCTCC 4 cut(s) 86, 197, 244, 357
LpnPI CCDG 7 cut(s) 31, 198, 262, 267, 315, 365, 406
LweI GCATC 2 cut(s) 128, 373
MaeIII GTNAC 1 cut(s) 272
MalI GATC 2 cut(s) 68, 378
MboI GATC 2 cut(s) 66, 376
MboII GAAGA 2 cut(s) 322, 358
MhlI GDGCHC 1 cut(s) 83
MlsI TGGCCA 1 cut(s) 204
MluCI AATT 3 cut(s) 255, 288, 340
MluNI TGGCCA 1 cut(s) 204
MmeI TCCRAC 1 cut(s) 56
MnlI CCTC 4 cut(s) 138, 163, 167, 395
Mox20I TGGCCA 1 cut(s) 204
MscI TGGCCA 1 cut(s) 204
Msp20I TGGCCA 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 147
NcoI CCATGG 1 cut(s) 199
NdeII GATC 2 cut(s) 66, 376
NlaIII CATG 2 cut(s) 203, 413
NlaIV GGNNCC 1 cut(s) 240
NmuCI GTSAC 1 cut(s) 272
NspI RCATGY 1 cut(s) 413
PflMI CCANNNNNTGG 2 cut(s) 38, 329
PspN4I GGNNCC 1 cut(s) 240
RsaI GTAC 1 cut(s) 211
RsaNI GTAC 1 cut(s) 210
Sau3AI GATC 2 cut(s) 66, 376
SduI GDGCHC 1 cut(s) 83
SetI ASST 5 cut(s) 38, 149, 159, 281, 362
SfaNI GCATC 2 cut(s) 128, 373
SmlI CTYRAG 1 cut(s) 142
SmoI CTYRAG 1 cut(s) 142
Sse9I AATT 3 cut(s) 255, 288, 340
SspI AATATT 1 cut(s) 88
StyI CCWWGG 2 cut(s) 199, 250
TaaI ACNGT 2 cut(s) 59, 209
TasI AATT 3 cut(s) 255, 288, 340
TscAI CASTG 1 cut(s) 334
TseFI GTSAC 1 cut(s) 272
Tsp45I GTSAC 1 cut(s) 272
TspGWI ACGGA 1 cut(s) 143
TspRI CASTG 1 cut(s) 334
Van91I CCANNNNNTGG 2 cut(s) 38, 329
XceI RCATGY 1 cut(s) 413
XcmI CCANNNNNNNNNTGG 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.