Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8271321.1

Orthogroup ID

OG0011738

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 746

Gene Structure 745 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8271321.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 745 bp

ctggtttggaagatttatgagcatattgtggaaaggaggagttatccgaatgatgagacggtgaggatcttgattgatgctttgtgcaaggaaggggagttgcggaaatgtgctgacatgttggagaggattcatgggaagaaatgttctccttctgtgattgtgaatgctagtttggtttttaggattttggaggagggtagagttgaagaaggtgtggtattgttgaagagaatgttgcagaagaatatggttcttgatacgattgcttactcattgattgttcatgctaaagttaaactaggaaatttaagctctgcacagcaggtgtatgaagaaatgcttaagagaggttttcgagcaaactcttttgtttataccttgttcattgaggcttattgtaaagctgaaagaattgatgaagcacaatccatgatgaatgagatgggaaatatggatttgaagccatatgctgagagctataattttcttattgagggatgtgctagagctggtagagtggaagaaagtgtgagttacttgaagcagatggtggagagcaggttcattcctagtcttggggctttcaatgagatggttggaaagctatgcgaaattggggatgtggaccaagccaatgtgatgttaacgatactgttagataaagggttcttaccgaatgacattacatactctcttctgattgacgggtatgcgagaaaaggggagaatgatgaagttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko05134 map05134

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

248

Amino Acids

28.25

Weight (kDa)

5.33

Isoelectric Point (pI)

33.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011738)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G66345
fragaria_vesca	FvH4_5g33100 FvH4_5g33100
prunus_persica	Prupe.4G237400_v2.0.a1
pyrus_communis	pycom11g17530
rosa_chinensis	RchiOBHm_Chr7g0231271 RchiOBHm_Chr7g0231291
rosa_laevigata	RLG00000001422
rosa_multiflora	Rmu_co8271321.1_g000001 Rmu_sc0003396.1_g000009 Rmu_sc0004571.1_g000005
rosa_rugosa	Rorug07G0266200
rosa_samantha	Rh7AG419400 Rh7AG419600 Rh7BG394600 Rh7CG439100 Rh7CG439200 Rh7DG413000
rosa_wichuraiana	Rw7G034670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	316
Acc36I	ACCTGC	2 cut(s)	316, 552
AciI	CCGC	1 cut(s)	103
AclWI	GGATC	1 cut(s)	74
AcsI	RAATTY	1 cut(s)	307
AfiI	CCNNNNNNNGG	1 cut(s)	578
AflII	CTTAAG	1 cut(s)	344
AflIII	ACRYGT	1 cut(s)	117
AgsI	TTSAA	5 cut(s)	209, 229, 463, 544, 589
AjuI	GAANNNNNNNTTGG	2 cut(s)	158, 190
AloI	GAACNNNNNNTCC	4 cut(s)	130, 162, 548, 580
AluBI	AGCT	5 cut(s)	315, 407, 480, 512, 607
AluI	AGCT	5 cut(s)	315, 407, 480, 512, 607
Alw26I	GTCTC	1 cut(s)	50
AlwI	GGATC	1 cut(s)	74
ApoI	RAATTY	1 cut(s)	307
AspS9I	GGNCC	1 cut(s)	628
AsuHPI	GGTGA	1 cut(s)	73
AvaII	GGWCC	1 cut(s)	628
BccI	CCATC	3 cut(s)	439, 544, 589
BcoDI	GTCTC	1 cut(s)	50
BfaI	CTAG	4 cut(s)	171, 302, 507, 573
BfrI	CTTAAG	1 cut(s)	344
BfuAI	ACCTGC	2 cut(s)	316, 552
Bme18I	GGWCC	1 cut(s)	628
BmgT120I	GGNCC	1 cut(s)	628
BmsI	GCATC	1 cut(s)	67
BsaXI	ACNNNNNCTCC	2 cut(s)	548, 578
Bsc4I	CCNNNNNNNGG	1 cut(s)	578
BseGI	GGATG	2 cut(s)	506, 628
BseLI	CCNNNNNNNGG	1 cut(s)	578
BseMII	CTCAG	1 cut(s)	465
BseRI	GAGGAG	2 cut(s)	52, 209
BsgI	GTGCAG	1 cut(s)	303
BslI	CCNNNNNNNGG	1 cut(s)	578
BsmAI	GTCTC	1 cut(s)	50
BsmBI	CGTCTC	1 cut(s)	50
BsmI	GAATGC	1 cut(s)	172
Bsp143I	GATC	1 cut(s)	66
BspACI	CCGC	1 cut(s)	103
BspCNI	CTCAG	1 cut(s)	466
BspMI	ACCTGC	2 cut(s)	316, 552
BspPI	GGATC	1 cut(s)	74
BspTI	CTTAAG	1 cut(s)	344
BssMI	GATC	1 cut(s)	66
Bst4CI	ACNGT	2 cut(s)	61, 657
Bst6I	CTCTTC	2 cut(s)	224, 702
BstAFI	CTTAAG	1 cut(s)	344
BstDEI	CTNAG	1 cut(s)	474
BstF5I	GGATG	2 cut(s)	506, 628
BstKTI	GATC	1 cut(s)	69
BstMAI	GTCTC	1 cut(s)	50
BstMBI	GATC	1 cut(s)	66
BstNSI	RCATGY	1 cut(s)	121
BstX2I	RGATCY	1 cut(s)	66
BstYI	RGATCY	1 cut(s)	66
BtsCI	GGATG	2 cut(s)	506, 628
BveI	ACCTGC	2 cut(s)	316, 552
Cfr13I	GGNCC	1 cut(s)	628
CviAII	CATG	4 cut(s)	118, 134, 287, 433
CviJI	RGCY	9 cut(s)	315, 395, 407, 466, 480, 512, 584, 607, 635
CviKI_1	RGCY	9 cut(s)	315, 395, 407, 466, 480, 512, 584, 607, 635
DdeI	CTNAG	1 cut(s)	474
DpnI	GATC	1 cut(s)	68
DpnII	GATC	1 cut(s)	66
Eam1104I	CTCTTC	2 cut(s)	224, 702
EarI	CTCTTC	2 cut(s)	224, 702
Eco47I	GGWCC	1 cut(s)	628
Esp3I	CGTCTC	1 cut(s)	50
FaeI	CATG	4 cut(s)	121, 137, 290, 436
FalI	AAGNNNNNCTT	2 cut(s)	327, 359
FatI	CATG	4 cut(s)	117, 133, 286, 432
FauNDI	CATATG	1 cut(s)	469
FokI	GGATG	2 cut(s)	513, 635
FspBI	CTAG	4 cut(s)	171, 302, 507, 573
Hin1II	CATG	4 cut(s)	121, 137, 290, 436
HincII	GTYRAC	1 cut(s)	648
HindII	GTYRAC	1 cut(s)	648
HinfI	GANTC	1 cut(s)	130
HpaI	GTTAAC	1 cut(s)	648
HphI	GGTGA	1 cut(s)	73
Hpy166II	GTNNAC	2 cut(s)	628, 648
Hpy188I	TCNGA	3 cut(s)	48, 702, 744
Hpy188III	TCNNGA	2 cut(s)	70, 257
Hpy8I	GTNNAC	2 cut(s)	628, 648
HpyAV	CCTTC	3 cut(s)	86, 162, 206
HpyCH4III	ACNGT	2 cut(s)	61, 657
HpyCH4V	TGCA	3 cut(s)	87, 241, 320
HpyF3I	CTNAG	1 cut(s)	474
Hsp92II	CATG	4 cut(s)	121, 137, 290, 436
KspAI	GTTAAC	1 cut(s)	648
Kzo9I	GATC	1 cut(s)	66
LpnPI	CCDG	3 cut(s)	311, 498, 547
LweI	GCATC	1 cut(s)	67
MaeI	CTAG	4 cut(s)	171, 302, 507, 573
MaeIII	GTNAC	1 cut(s)	536
MalI	GATC	1 cut(s)	68
MboI	GATC	1 cut(s)	66
MboII	GAAGA	8 cut(s)	22, 151, 221, 241, 256, 347, 536, 689
MflI	RGATCY	1 cut(s)	66
MluCI	AATT	4 cut(s)	307, 414, 484, 615
MmeI	TCCRAC	2 cut(s)	102, 580
MnlI	CCTC	8 cut(s)	30, 57, 120, 187, 190, 344, 385, 490
MseI	TTAA	4 cut(s)	297, 311, 345, 647
MspCI	CTTAAG	1 cut(s)	344
Mva1269I	GAATGC	1 cut(s)	172
NdeI	CATATG	1 cut(s)	469
NdeII	GATC	1 cut(s)	66
NlaIII	CATG	4 cut(s)	121, 137, 290, 436
NspI	RCATGY	1 cut(s)	121
PaqCI	CACCTGC	1 cut(s)	316
PciI	ACATGT	1 cut(s)	117
PctI	GAATGC	1 cut(s)	172
PfeI	GAWTC	1 cut(s)	130
PscI	ACATGT	1 cut(s)	117
PspPI	GGNCC	1 cut(s)	628
PsuI	RGATCY	1 cut(s)	66
SaqAI	TTAA	4 cut(s)	297, 311, 345, 647
Sau3AI	GATC	1 cut(s)	66
Sau96I	GGNCC	1 cut(s)	628
SfaNI	GCATC	1 cut(s)	67
SinI	GGWCC	1 cut(s)	628
SmlI	CTYRAG	1 cut(s)	344
SmoI	CTYRAG	1 cut(s)	344
Sse9I	AATT	4 cut(s)	307, 414, 484, 615
SsiI	CCGC	1 cut(s)	103
SspMI	CTAG	4 cut(s)	171, 302, 507, 573
TaaI	ACNGT	2 cut(s)	61, 657
TaqI	TCGA	1 cut(s)	358
TasI	AATT	4 cut(s)	307, 414, 484, 615
TfiI	GAWTC	1 cut(s)	130
Tru1I	TTAA	4 cut(s)	297, 311, 345, 647
Tru9I	TTAA	4 cut(s)	297, 311, 345, 647
TspDTI	ATGAA	7 cut(s)	122, 275, 348, 376, 435, 452, 556
Vha464I	CTTAAG	1 cut(s)	344
VpaK11BI	GGWCC	1 cut(s)	628
XapI	RAATTY	1 cut(s)	307
XceI	RCATGY	1 cut(s)	121
XspI	CTAG	4 cut(s)	171, 302, 507, 573

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.