Rmu_co8274213.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8274213.1
Physical Location & Seq
Forward (+)
20 .. 834
815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8274213.1_g000001.1.cds

Sequence Viewer

Length: 815 bp
atgcctgaaagagatgtggcatgttggaatactgcaatttcttgttattatcaaaatgggcaagctcagaaggcaatggacttgtatgagaagatgaggagttctggctttgagcctaatgtagtaacgatcactactgttatttcatcatgtgcaagacttttggatttggagagaggtagggagattcacaaggagttgatacaaaatcgattcgttttggattcctttgttagttctgctttggtagacatgtatgggaaatgtggatgtttagatatggcaaaagagatttttgaacaagtcccaagaaagaatgtcatcgcttggaactccatgattgcagcctatcgtgtaacaggtgacagtaaatcttgtatcgatctttttagaaggatgactgatgaaggaactagtccctctttgattacttttagcagcattttgttggctagttcaagatcggtccaacttcaacatggaaaattcctgcacgcgtatatgataagaaactatgtagaggctgatatctatgtttacagttcgcttattgatctctactttgtgtgtggaagtatctcgtctgctaaaaatgtctttgaaaagatgtccaagacaaatgtagtttcttggaatgttatgatttctggattcgtgaaagtgggaaattatttcagggctctagggttatatgatgagatgaaagaagctggtgtaaggccaaacgccatcacggtaactagtatcctatcggcttgttcacaactaacagcactggaaaagggtaaggagattcacagaactgttgttgatag

Protein Analysis

271

Amino Acids

30.44

Weight (kDa)

8.05

Isoelectric Point (pI)

46.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 249
AccII CGCG 1 cut(s) 497
AcsI RAATTY 1 cut(s) 485
AflIII ACRYGT 2 cut(s) 252, 495
AgsI TTSAA 4 cut(s) 299, 459, 476, 602
AhlI ACTAGT 2 cut(s) 413, 740
AluBI AGCT 2 cut(s) 65, 710
AluI AGCT 2 cut(s) 65, 710
AoxI GGCC 1 cut(s) 719
ApeKI GCWGC 2 cut(s) 344, 438
ApoI RAATTY 1 cut(s) 485
AspS9I GGNCC 1 cut(s) 466
AsuHPI GGTGA 1 cut(s) 374
AvaII GGWCC 1 cut(s) 466
BanII GRGCYC 1 cut(s) 682
BbvI GCAGC 2 cut(s) 356, 450
BccI CCATC 1 cut(s) 737
BciVI GTATCC 1 cut(s) 755
BcuI ACTAGT 2 cut(s) 413, 740
BfaI CTAG 4 cut(s) 414, 453, 683, 741
BfuI GTATCC 1 cut(s) 755
BisI GCNGC 2 cut(s) 345, 439
BlsI GCNGC 2 cut(s) 346, 440
Bme18I GGWCC 1 cut(s) 466
BmgT120I GGNCC 1 cut(s) 466
Bsa29I ATCGAT 2 cut(s) 211, 381
Bse1I ACTGG 1 cut(s) 780
Bse3DI GCAATG 1 cut(s) 81
BseCI ATCGAT 2 cut(s) 211, 381
BseGI GGATG 2 cut(s) 275, 402
BseMI GCAATG 1 cut(s) 81
BseMII CTCAG 1 cut(s) 80
BseNI ACTGG 1 cut(s) 780
BseRI GAGGAG 1 cut(s) 112
BseXI GCAGC 2 cut(s) 356, 450
BsgI GTGCAG 1 cut(s) 476
Bsh1236I CGCG 1 cut(s) 497
BshFI GGCC 1 cut(s) 721
BshVI ATCGAT 2 cut(s) 211, 381
BslFI GGGAC 2 cut(s) 290, 402
BsmFI GGGAC 2 cut(s) 290, 402
BsnI GGCC 1 cut(s) 721
Bsp1286I GDGCHC 1 cut(s) 682
Bsp143I GATC 4 cut(s) 129, 382, 461, 553
BspANI GGCC 1 cut(s) 721
BspCNI CTCAG 1 cut(s) 79
BspDI ATCGAT 2 cut(s) 211, 381
BspFNI CGCG 1 cut(s) 497
BsrDI GCAATG 1 cut(s) 81
BsrI ACTGG 1 cut(s) 780
BssMI GATC 4 cut(s) 129, 382, 461, 553
Bst4CI ACNGT 5 cut(s) 139, 368, 542, 736, 805
BstC8I GCNNGC 2 cut(s) 63, 495
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 2 cut(s) 275, 402
BstFNI CGCG 1 cut(s) 497
BstKTI GATC 4 cut(s) 132, 385, 464, 556
BstMBI GATC 4 cut(s) 129, 382, 461, 553
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstNSI RCATGY 2 cut(s) 24, 256
BstUI CGCG 1 cut(s) 497
BstV1I GCAGC 2 cut(s) 356, 450
Bsu15I ATCGAT 2 cut(s) 211, 381
BsuI GTATCC 1 cut(s) 755
BsuRI GGCC 1 cut(s) 721
BsuTUI ATCGAT 2 cut(s) 211, 381
BtgZI GCGATG 1 cut(s) 307
BtsCI GGATG 2 cut(s) 275, 402
BtsIMutI CAGTG 1 cut(s) 773
Cac8I GCNNGC 2 cut(s) 63, 495
Cfr13I GGNCC 1 cut(s) 466
ClaI ATCGAT 2 cut(s) 211, 381
CviAII CATG 5 cut(s) 21, 150, 253, 337, 479
DdeI CTNAG 1 cut(s) 66
DpnI GATC 4 cut(s) 131, 384, 463, 555
DpnII GATC 4 cut(s) 129, 382, 461, 553
Eco24I GRGCYC 1 cut(s) 682
Eco32I GATATC 1 cut(s) 529
Eco47I GGWCC 1 cut(s) 466
EcoRV GATATC 1 cut(s) 529
EcoT38I GRGCYC 1 cut(s) 682
FaeI CATG 5 cut(s) 24, 153, 256, 340, 482
FaqI GGGAC 2 cut(s) 290, 402
FatI CATG 5 cut(s) 20, 149, 252, 336, 478
FblI GTMKAC 1 cut(s) 249
Fnu4HI GCNGC 2 cut(s) 345, 439
FokI GGATG 2 cut(s) 282, 409
FriOI GRGCYC 1 cut(s) 682
Fsp4HI GCNGC 2 cut(s) 345, 439
FspBI CTAG 4 cut(s) 414, 453, 683, 741
GluI GCNGC 2 cut(s) 345, 439
HaeIII GGCC 1 cut(s) 721
Hin1II CATG 5 cut(s) 24, 153, 256, 340, 482
HinfI GANTC 5 cut(s) 187, 213, 224, 651, 793
HphI GGTGA 1 cut(s) 374
Hpy166II GTNNAC 3 cut(s) 250, 538, 761
Hpy188I TCNGA 1 cut(s) 69
Hpy188III TCNNGA 3 cut(s) 459, 648, 655
Hpy8I GTNNAC 3 cut(s) 250, 538, 761
HpyAV CCTTC 3 cut(s) 64, 387, 401
HpyCH4III ACNGT 5 cut(s) 139, 368, 542, 736, 805
HpyCH4V TGCA 4 cut(s) 35, 155, 344, 493
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 5 cut(s) 24, 153, 256, 340, 482
Kzo9I GATC 4 cut(s) 129, 382, 461, 553
LpnPI CCDG 8 cut(s) 18, 90, 345, 503, 633, 661, 696, 761
Lsp1109I GCAGC 2 cut(s) 356, 450
MaeI CTAG 4 cut(s) 414, 453, 683, 741
MaeIII GTNAC 4 cut(s) 124, 355, 362, 736
MalI GATC 4 cut(s) 131, 384, 463, 555
MboI GATC 4 cut(s) 129, 382, 461, 553
MboII GAAGA 1 cut(s) 103
MhlI GDGCHC 1 cut(s) 682
MluCI AATT 3 cut(s) 36, 485, 667
MluI ACGCGT 1 cut(s) 495
MmeI TCCRAC 2 cut(s) 5, 493
MnlI CCTC 4 cut(s) 90, 170, 430, 514
MvnI CGCG 1 cut(s) 497
MwoI GCNNNNNNNGC 1 cut(s) 71
NdeII GATC 4 cut(s) 129, 382, 461, 553
NlaIII CATG 5 cut(s) 24, 153, 256, 340, 482
NmuCI GTSAC 1 cut(s) 362
NspI RCATGY 2 cut(s) 24, 256
PciI ACATGT 1 cut(s) 252
PfeI GAWTC 5 cut(s) 187, 213, 224, 651, 793
PkrI GCNGC 2 cut(s) 346, 440
PscI ACATGT 1 cut(s) 252
PspPI GGNCC 1 cut(s) 466
SatI GCNGC 2 cut(s) 345, 439
Sau3AI GATC 4 cut(s) 129, 382, 461, 553
Sau96I GGNCC 1 cut(s) 466
SduI GDGCHC 1 cut(s) 682
SetI ASST 4 cut(s) 67, 181, 364, 712
SinI GGWCC 1 cut(s) 466
SpeI ACTAGT 2 cut(s) 413, 740
Sse9I AATT 3 cut(s) 36, 485, 667
SspMI CTAG 4 cut(s) 414, 453, 683, 741
TaaI ACNGT 5 cut(s) 139, 368, 542, 736, 805
TaqI TCGA 2 cut(s) 211, 381
TaqII GACCGA 1 cut(s) 454
TasI AATT 3 cut(s) 36, 485, 667
TfiI GAWTC 5 cut(s) 187, 213, 224, 651, 793
TscAI CASTG 1 cut(s) 780
TseFI GTSAC 1 cut(s) 362
TseI GCWGC 2 cut(s) 344, 438
Tsp45I GTSAC 1 cut(s) 362
TspDTI ATGAA 3 cut(s) 135, 420, 716
TspRI CASTG 1 cut(s) 780
VpaK11BI GGWCC 1 cut(s) 466
XapI RAATTY 1 cut(s) 485
XceI RCATGY 2 cut(s) 24, 256
XcmI CCANNNNNNNNNTGG 1 cut(s) 476
XmiI GTMKAC 1 cut(s) 249
XspI CTAG 4 cut(s) 414, 453, 683, 741
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.