Rmu_co8290787.1_g000001

ankyrin repeat family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8290787.1
Physical Location & Seq
Forward (+)
1 .. 776
776 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8290787.1_g000001.1.cds

Sequence Viewer

Length: 374 bp
ataacttagaaggcagtattgatgaaccagtggaagatggggacacagctctgcatctggcttgtctctatggtaaactttcttgtgtccagttgcttttggagaggggggcaaacttggaggctaaggatgaagatggagctattcctctgcatgatgcttgtgctgggggatacactgagatagttcaacttctagttaacagtgctaatgacaccgagcgtgtaaagagaatgctagaagcagttgacgctgaaggtgatactcctctgcatcatgcagccagaggtgagcatgctgatattataagattgttgctggcttctggagcttctcctacaagggcaaacctgtatggaaaggttcgtcgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.18

Weight (kDa)

4.87

Isoelectric Point (pI)

26.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014540)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G09890 AT3G09890
fragaria_vesca FvH4_6g16830
malus_domestica MD12G1106800.v1.1
prunus_persica Prupe.7G125700_v2.0.a1
pyrus_communis pycom12g10730
rosa_chinensis RchiOBHm_Chr3g0470841
rosa_laevigata RLG00000024241
rosa_multiflora Rmu_co8290787.1_g000001 Rmu_sc0002790.1_g000024
rosa_roxburghii Rroxscaffold_6G00410490
rosa_rugosa Rorug03G0113100
rosa_samantha Rh3AG162800 Rh3BG187900 Rh3CG177900 Rh3DG187900
rosa_wichuraiana Rw3G015330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 307
AcuI CTGAAG 1 cut(s) 275
AgsI TTSAA 1 cut(s) 190
AluBI AGCT 3 cut(s) 49, 142, 331
AluI AGCT 3 cut(s) 49, 142, 331
Alw26I GTCTC 1 cut(s) 70
ApeKI GCWGC 1 cut(s) 280
AsuHPI GGTGA 2 cut(s) 271, 301
BbvI GCAGC 1 cut(s) 292
BccI CCATC 2 cut(s) 31, 130
BciVI GTATCC 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 2 cut(s) 196, 238
BfuI GTATCC 1 cut(s) 166
BisI GCNGC 1 cut(s) 281
BlsI GCNGC 1 cut(s) 282
BmsI GCATC 3 cut(s) 63, 147, 282
BpmI CTGGAG 1 cut(s) 347
Bpu10I CCTNAGC 1 cut(s) 125
Bse1I ACTGG 2 cut(s) 28, 90
BseGI GGATG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 170
BseNI ACTGG 2 cut(s) 28, 90
BseRI GAGGAG 1 cut(s) 257
BseXI GCAGC 1 cut(s) 292
BseYI CCCAGC 1 cut(s) 166
BslFI GGGAC 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 70
BsmFI GGGAC 1 cut(s) 55
BsmI GAATGC 1 cut(s) 239
BspCNI CTCAG 1 cut(s) 171
BsrI ACTGG 2 cut(s) 28, 90
Bst4CI ACNGT 1 cut(s) 205
BstC8I GCNNGC 2 cut(s) 296, 320
BstDEI CTNAG 3 cut(s) 6, 125, 179
BstF5I GGATG 1 cut(s) 135
BstMAI GTCTC 1 cut(s) 70
BstMWI GCNNNNNNNGC 2 cut(s) 250, 328
BstNSI RCATGY 1 cut(s) 298
BstV1I GCAGC 1 cut(s) 292
BsuI GTATCC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 135
BtsIMutI CAGTG 3 cut(s) 35, 176, 210
Cac8I GCNNGC 2 cut(s) 296, 320
CseI GACGC 1 cut(s) 259
CviAII CATG 3 cut(s) 154, 277, 295
CviJI RGCY 7 cut(s) 49, 61, 124, 142, 283, 322, 331
CviKI_1 RGCY 7 cut(s) 49, 61, 124, 142, 283, 322, 331
DdeI CTNAG 3 cut(s) 6, 125, 179
Eco57I CTGAAG 1 cut(s) 275
FaeI CATG 3 cut(s) 157, 280, 298
FaiI YATR 6 cut(s) 71, 155, 278, 296, 307, 356
FaqI GGGAC 1 cut(s) 55
FatI CATG 3 cut(s) 153, 276, 294
Fnu4HI GCNGC 1 cut(s) 281
FokI GGATG 1 cut(s) 142
Fsp4HI GCNGC 1 cut(s) 281
FspBI CTAG 2 cut(s) 196, 238
GluI GCNGC 1 cut(s) 281
GsaI CCCAGC 1 cut(s) 170
GsuI CTGGAG 1 cut(s) 347
HgaI GACGC 1 cut(s) 259
Hin1II CATG 3 cut(s) 157, 280, 298
HincII GTYRAC 2 cut(s) 201, 249
HindII GTYRAC 2 cut(s) 201, 249
HpaI GTTAAC 1 cut(s) 201
HphI GGTGA 2 cut(s) 271, 301
Hpy166II GTNNAC 3 cut(s) 76, 201, 249
Hpy188III TCNNGA 1 cut(s) 326
Hpy8I GTNNAC 3 cut(s) 76, 201, 249
Hpy99I CGWCG 1 cut(s) 371
HpyAV CCTTC 2 cut(s) 4, 250
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 4 cut(s) 54, 153, 273, 280
HpyF10VI GCNNNNNNNGC 2 cut(s) 250, 328
HpyF3I CTNAG 3 cut(s) 6, 125, 179
Hsp92II CATG 3 cut(s) 157, 280, 298
KspAI GTTAAC 1 cut(s) 201
LmnI GCTCC 2 cut(s) 139, 328
LpnPI CCDG 8 cut(s) 41, 43, 103, 152, 297, 304, 311, 364
Lsp1109I GCAGC 1 cut(s) 292
LweI GCATC 3 cut(s) 63, 147, 282
MaeI CTAG 2 cut(s) 196, 238
MboII GAAGA 2 cut(s) 46, 145
MnlI CCTC 5 cut(s) 98, 114, 158, 278, 280
MseI TTAA 1 cut(s) 200
Mva1269I GAATGC 1 cut(s) 239
MwoI GCNNNNNNNGC 2 cut(s) 250, 328
NlaIII CATG 3 cut(s) 157, 280, 298
NspI RCATGY 1 cut(s) 298
PaeI GCATGC 1 cut(s) 298
PctI GAATGC 1 cut(s) 239
PkrI GCNGC 1 cut(s) 282
PsiI TTATAA 1 cut(s) 307
PspFI CCCAGC 1 cut(s) 166
SaqAI TTAA 1 cut(s) 200
SatI GCNGC 1 cut(s) 281
SetI ASST 7 cut(s) 51, 144, 261, 291, 333, 353, 365
SfaNI GCATC 3 cut(s) 63, 147, 282
SphI GCATGC 1 cut(s) 298
SspMI CTAG 2 cut(s) 196, 238
TaaI ACNGT 1 cut(s) 205
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TscAI CASTG 3 cut(s) 35, 183, 210
TseI GCWGC 1 cut(s) 280
TspDTI ATGAA 2 cut(s) 38, 146
TspRI CASTG 3 cut(s) 35, 183, 210
XceI RCATGY 1 cut(s) 298
XspI CTAG 2 cut(s) 196, 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.