Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8300969.1

Orthogroup ID

OG0008417

Physical Location & Seq

Genomic Coordinates Forward (+)

59 .. 894

Gene Structure 836 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8300969.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 836 bp

atgatcagatttgaggacatccatgctacatccctcaacgtgattttgggttctgtagatcctacccccgaaagcttggttggttacaggttatggcatcgtaaggctcaagatatgagttatccagcagagccaacatgcacattgttaccaccaaagacaaagtttattgtcacaggactaattccagctacagaatactgctttaaagtcacttcatttgatggttcaagacatctgggcatgtgtgaagttcggatctccacaagtactgctggggatgaagttgcaaattgttcagtcacagagcgaagtcaaagcccagctaccaactatagtggcctttctaatccatcttcagtggaagatgaaactaataacatcactccctatagtgatcaagctgataaccgagcagacacttaccgtaatcaatgcgaggacactgaaaagtctacttctgctaatttgtcaaatggtgctatcacctgcaatagcatcggcagaggacctacagaagccaatacagtttctttgctggatgaggaacatgcggcctccatatccaatttcgacgtcctaaaacctgagtgcaagcaatcacccgaatgtcaaattattgaagacatcagtactggtaatgggtccaattcccctgttcgaactggaatggaatgtgtgccctttgttaatagctcagaagcttgcttgcccatcactccatgcaaattggaaacacttaaagatgggttaggaaggaacgcaagatccaattccagctgcaaggatttgaaaaatggggctgggaaaggggaggaaccccaagatggcagtac

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001666 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005677 GO:0005911 GO:0006950 GO:0007623 GO:0008150 GO:0009266 GO:0009409 GO:0009506 GO:0009628 GO:0009892 GO:0009893 GO:0009987 GO:0010048 GO:0010468 GO:0010604 GO:0010605 GO:0010629 GO:0010638 GO:0016604 GO:0016607 GO:0017053 GO:0019222 GO:0030054 GO:0031056 GO:0031058 GO:0031060 GO:0031062 GO:0031323 GO:0031325 GO:0031399 GO:0031401 GO:0031519 GO:0031974 GO:0031981 GO:0032268 GO:0032270 GO:0032501 GO:0032922 GO:0032991 GO:0033043 GO:0033044 GO:0033554 GO:0035064 GO:0036293 GO:0040029 GO:0042393 GO:0042802 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0045814 GO:0048511 GO:0048518 GO:0048519 GO:0048522 GO:0048580 GO:0048583 GO:0048587 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051128 GO:0051130 GO:0051171 GO:0051173 GO:0051239 GO:0051246 GO:0051247 GO:0051569 GO:0051570 GO:0051571 GO:0051574 GO:0051716 GO:0055044 GO:0060255 GO:0061085 GO:0061087 GO:0065007 GO:0070013 GO:0070417 GO:0070482 GO:0080090 GO:0090568 GO:0140030 GO:0140034 GO:1900109 GO:1900111 GO:1902275 GO:1905269 GO:2000026 GO:2000028 GO:2000241 GO:2001252

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PHD_Oberon fn3

Protein Analysis

279

Amino Acids

29.99

Weight (kDa)

4.74

Isoelectric Point (pI)

50.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008417)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G30200 AT4G30200 AT4G30200 AT4G30200
fragaria_vesca	FvH4_4g08010 FvH4_4g08010
malus_domestica	MD13G1252500.v1.1 MD16G1256500.v1.1
prunus_persica	Prupe.1G084700_v2.0.a1
pyrus_communis	pycom13g22550 pycom16g21760
rosa_chinensis	RchiOBHm_Chr4g0401761
rosa_laevigata	RLG00000009127
rosa_multiflora	Rmu_co8300969.1_g000001 Rmu_sc0001405.1_g000016
rosa_roxburghii	Rroxscaffold_5G00346250
rosa_rugosa	Rorug04G0032100 Rorug04G0032200
rosa_samantha	Rh4AG109000 Rh4BG102800 Rh4CG117300 Rh4DG100500
rosa_wichuraiana	Rw4G008850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	497
AatII	GACGTC	1 cut(s)	579
Acc36I	ACCTGC	1 cut(s)	497
AccI	GTMKAC	1 cut(s)	455
AciI	CCGC	1 cut(s)	554
AclWI	GGATC	3 cut(s)	53, 266, 762
AcuI	CTGAAG	1 cut(s)	342
AcyI	GRCGYC	1 cut(s)	576
AfaI	GTAC	3 cut(s)	271, 634, 835
AfiI	CCNNNNNNNGG	1 cut(s)	827
AgsI	TTSAA	3 cut(s)	231, 623, 793
AjuI	GAANNNNNNNTTGG	2 cut(s)	63, 95
AloI	GAACNNNNNNTCC	2 cut(s)	752, 784
AluBI	AGCT	7 cut(s)	75, 191, 326, 404, 696, 704, 780
AluI	AGCT	7 cut(s)	75, 191, 326, 404, 696, 704, 780
AlwI	GGATC	3 cut(s)	53, 266, 762
AoxI	GGCC	2 cut(s)	340, 555
ApeKI	GCWGC	1 cut(s)	780
AspS9I	GGNCC	2 cut(s)	509, 645
AsuHPI	GGTGA	2 cut(s)	478, 594
AsuII	TTCGAA	1 cut(s)	661
AvaII	GGWCC	2 cut(s)	509, 645
BaeGI	GKGCMC	1 cut(s)	684
BbsI	GAAGAC	1 cut(s)	630
BbvI	GCAGC	1 cut(s)	767
BccI	CCATC	5 cut(s)	218, 361, 722, 740, 821
BcgI	CGANNNNNNTGC	2 cut(s)	481, 515
BclI	TGATCA	2 cut(s)	3, 397
BfmI	CTRYAG	5 cut(s)	54, 192, 334, 391, 513
BfuAI	ACCTGC	1 cut(s)	497
BisI	GCNGC	2 cut(s)	555, 781
BlsI	GCNGC	2 cut(s)	556, 782
BmcAI	AGTACT	2 cut(s)	271, 634
Bme18I	GGWCC	2 cut(s)	509, 645
BmgT120I	GGNCC	2 cut(s)	509, 645
BmiI	GGNNCC	2 cut(s)	646, 819
BmsI	GCATC	2 cut(s)	106, 507
BpiI	GAAGAC	1 cut(s)	630
Bpu14I	TTCGAA	1 cut(s)	661
BpuEI	CTTGAG	1 cut(s)	93
BsaHI	GRCGYC	1 cut(s)	576
Bsc4I	CCNNNNNNNGG	1 cut(s)	827
Bse1I	ACTGG	2 cut(s)	640, 670
BseGI	GGATG	4 cut(s)	18, 29, 286, 547
BseLI	CCNNNNNNNGG	1 cut(s)	827
BseMII	CTCAG	2 cut(s)	579, 711
BseNI	ACTGG	2 cut(s)	640, 670
BseSI	GKGCMC	1 cut(s)	684
BseXI	GCAGC	1 cut(s)	767
BseYI	CCCAGC	3 cut(s)	275, 322, 803
BshFI	GGCC	2 cut(s)	342, 557
BslI	CCNNNNNNNGG	1 cut(s)	827
BsnI	GGCC	2 cut(s)	342, 557
Bsp119I	TTCGAA	1 cut(s)	661
Bsp1286I	GDGCHC	1 cut(s)	684
Bsp143I	GATC	5 cut(s)	3, 58, 258, 397, 767
BspACI	CCGC	1 cut(s)	554
BspANI	GGCC	2 cut(s)	342, 557
BspCNI	CTCAG	2 cut(s)	580, 710
BspLI	GGNNCC	2 cut(s)	646, 819
BspMI	ACCTGC	1 cut(s)	497
BspPI	GGATC	3 cut(s)	53, 266, 762
BspT104I	TTCGAA	1 cut(s)	661
BsrI	ACTGG	2 cut(s)	640, 670
BssMI	GATC	5 cut(s)	3, 58, 258, 397, 767
BssNI	GRCGYC	1 cut(s)	576
Bst4CI	ACNGT	2 cut(s)	428, 529
BstACI	GRCGYC	1 cut(s)	576
BstBI	TTCGAA	1 cut(s)	661
BstC8I	GCNNGC	3 cut(s)	596, 706, 710
BstDEI	CTNAG	2 cut(s)	588, 697
BstF5I	GGATG	4 cut(s)	18, 29, 286, 547
BstKTI	GATC	5 cut(s)	6, 61, 261, 400, 770
BstMBI	GATC	5 cut(s)	3, 58, 258, 397, 767
BstNSI	RCATGY	3 cut(s)	141, 247, 554
BstSFI	CTRYAG	5 cut(s)	54, 192, 334, 391, 513
BstSLI	GKGCMC	1 cut(s)	684
BstV1I	GCAGC	1 cut(s)	767
BstV2I	GAAGAC	1 cut(s)	630
BstX2I	RGATCY	3 cut(s)	58, 258, 767
BstYI	RGATCY	3 cut(s)	58, 258, 767
BsuRI	GGCC	2 cut(s)	342, 557
BtsCI	GGATG	4 cut(s)	18, 29, 286, 547
BtsIMutI	CAGTG	2 cut(s)	366, 444
BveI	ACCTGC	1 cut(s)	497
Cac8I	GCNNGC	3 cut(s)	596, 706, 710
Cfr13I	GGNCC	2 cut(s)	509, 645
Csp6I	GTAC	3 cut(s)	270, 633, 834
CspCI	CAANNNNNGTGG	2 cut(s)	319, 354
CviAII	CATG	5 cut(s)	23, 138, 244, 551, 723
CviQI	GTAC	3 cut(s)	270, 633, 834
DdeI	CTNAG	2 cut(s)	588, 697
DpnI	GATC	5 cut(s)	5, 60, 260, 399, 769
DpnII	GATC	5 cut(s)	3, 58, 258, 397, 767
DraI	TTTAAA	1 cut(s)	208
Eco47I	GGWCC	2 cut(s)	509, 645
Eco57I	CTGAAG	1 cut(s)	342
EcoO109I	RGGNCCY	1 cut(s)	509
FaeI	CATG	5 cut(s)	26, 141, 247, 554, 726
FatI	CATG	5 cut(s)	22, 137, 243, 550, 722
FbaI	TGATCA	2 cut(s)	3, 397
FblI	GTMKAC	1 cut(s)	455
Fnu4HI	GCNGC	2 cut(s)	555, 781
FokI	GGATG	4 cut(s)	5, 16, 293, 554
Fsp4HI	GCNGC	2 cut(s)	555, 781
GluI	GCNGC	2 cut(s)	555, 781
GsaI	CCCAGC	3 cut(s)	279, 326, 807
HaeIII	GGCC	2 cut(s)	342, 557
Hin1I	GRCGYC	1 cut(s)	576
Hin1II	CATG	5 cut(s)	26, 141, 247, 554, 726
HindIII	AAGCTT	2 cut(s)	73, 702
HphI	GGTGA	2 cut(s)	478, 594
Hpy166II	GTNNAC	1 cut(s)	456
Hpy188I	TCNGA	3 cut(s)	8, 258, 700
Hpy188III	TCNNGA	2 cut(s)	110, 231
Hpy8I	GTNNAC	1 cut(s)	456
Hpy99I	CGWCG	1 cut(s)	578
HpyAV	CCTTC	1 cut(s)	750
HpyCH4III	ACNGT	2 cut(s)	428, 529
HpyCH4IV	ACGT	2 cut(s)	39, 576
HpyCH4V	TGCA	6 cut(s)	141, 290, 492, 594, 726, 783
HpyF3I	CTNAG	2 cut(s)	588, 697
HpySE526I	ACGT	2 cut(s)	39, 576
Hsp92I	GRCGYC	1 cut(s)	576
Hsp92II	CATG	5 cut(s)	26, 141, 247, 554, 726
Ksp22I	TGATCA	2 cut(s)	3, 397
Kzo9I	GATC	5 cut(s)	3, 58, 258, 397, 767
Lsp1109I	GCAGC	1 cut(s)	767
LweI	GCATC	2 cut(s)	106, 507
MaeII	ACGT	2 cut(s)	39, 576
MaeIII	GTNAC	5 cut(s)	83, 147, 172, 211, 301
MalI	GATC	5 cut(s)	5, 60, 260, 399, 769
MboI	GATC	5 cut(s)	3, 58, 258, 397, 767
MboII	GAAGA	3 cut(s)	348, 377, 635
MflI	RGATCY	3 cut(s)	58, 258, 767
MhlI	GDGCHC	1 cut(s)	684
MluCI	AATT	8 cut(s)	183, 292, 466, 568, 615, 649, 728, 772
MnlI	CCTC	7 cut(s)	7, 44, 433, 500, 538, 568, 808
MseI	TTAA	3 cut(s)	207, 690, 741
MslI	CAYNNNNRTG	1 cut(s)	607
MspA1I	CMGCKG	1 cut(s)	780
NdeII	GATC	5 cut(s)	3, 58, 258, 397, 767
NlaIII	CATG	5 cut(s)	26, 141, 247, 554, 726
NlaIV	GGNNCC	2 cut(s)	646, 819
NmuCI	GTSAC	3 cut(s)	172, 211, 301
NspI	RCATGY	3 cut(s)	141, 247, 554
NspV	TTCGAA	1 cut(s)	661
PaqCI	CACCTGC	1 cut(s)	497
PkrI	GCNGC	2 cut(s)	556, 782
PpuMI	RGGWCCY	1 cut(s)	509
Psp5II	RGGWCCY	1 cut(s)	509
PspFI	CCCAGC	3 cut(s)	275, 322, 803
PspN4I	GGNNCC	2 cut(s)	646, 819
PspPI	GGNCC	2 cut(s)	509, 645
PspPPI	RGGWCCY	1 cut(s)	509
PsuI	RGATCY	3 cut(s)	58, 258, 767
PvuII	CAGCTG	1 cut(s)	780
RsaI	GTAC	3 cut(s)	271, 634, 835
RsaNI	GTAC	3 cut(s)	270, 633, 834
RseI	CAYNNNNRTG	1 cut(s)	607
SaqAI	TTAA	3 cut(s)	207, 690, 741
SatI	GCNGC	2 cut(s)	555, 781
Sau3AI	GATC	5 cut(s)	3, 58, 258, 397, 767
Sau96I	GGNCC	2 cut(s)	509, 645
ScaI	AGTACT	2 cut(s)	271, 634
SduI	GDGCHC	1 cut(s)	684
SfaNI	GCATC	2 cut(s)	106, 507
SfcI	CTRYAG	5 cut(s)	54, 192, 334, 391, 513
SfuI	TTCGAA	1 cut(s)	661
SinI	GGWCC	2 cut(s)	509, 645
SmiMI	CAYNNNNRTG	1 cut(s)	607
SmlI	CTYRAG	1 cut(s)	108
SmoI	CTYRAG	1 cut(s)	108
Sse9I	AATT	8 cut(s)	183, 292, 466, 568, 615, 649, 728, 772
SsiI	CCGC	1 cut(s)	554
TaaI	ACNGT	2 cut(s)	428, 529
TaiI	ACGT	2 cut(s)	42, 579
TaqI	TCGA	2 cut(s)	573, 661
TasI	AATT	8 cut(s)	183, 292, 466, 568, 615, 649, 728, 772
TatI	WGTACW	2 cut(s)	269, 632
TauI	GCSGC	1 cut(s)	557
Tru1I	TTAA	3 cut(s)	207, 690, 741
Tru9I	TTAA	3 cut(s)	207, 690, 741
TscAI	CASTG	2 cut(s)	366, 451
TseFI	GTSAC	3 cut(s)	172, 211, 301
TseI	GCWGC	1 cut(s)	780
Tsp45I	GTSAC	3 cut(s)	172, 211, 301
TspDTI	ATGAA	3 cut(s)	207, 297, 384
TspRI	CASTG	2 cut(s)	366, 451
VpaK11BI	GGWCC	2 cut(s)	509, 645
XceI	RCATGY	3 cut(s)	141, 247, 554
XmiI	GTMKAC	1 cut(s)	455
ZraI	GACGTC	1 cut(s)	577
ZrmI	AGTACT	2 cut(s)	271, 634

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.