Rorug04G0032100

Protein VERNALIZATION INSENSITIVE

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
4693018 .. 4693236
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0032100.1

Sequence Viewer

Length: 219 bp
ATGAATTTGTTTTGTGAGAAAAACATAATAACTACTAATTGGCGGAGTGCTGAATTAGACACGTATCAATTCTTCAACAAGCTTTATAAGGACACCTCGCTTAAGGAGTTCTTGTATGATGGACTGTGCTACCAAGTAAATGAACATTACCAAGTTGCACAGGACAAAAAGCTTCAAAGAATGAGGCGTGAGCTACGAACTACTGCAGTTGAAGCGTGA

Protein Analysis

72

Amino Acids

8.76

Weight (kDa)

7.75

Isoelectric Point (pI)

34.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 3 - 68 5.2e-06 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 87
AciI CCGC 1 cut(s) 43
AcsI RAATTY 1 cut(s) 4
AflII CTTAAG 1 cut(s) 101
AflIII ACRYGT 1 cut(s) 60
AgsI TTSAA 3 cut(s) 76, 176, 212
AluBI AGCT 3 cut(s) 82, 172, 193
AluI AGCT 3 cut(s) 82, 172, 193
ApoI RAATTY 1 cut(s) 4
BarI GAAGNNNNNNTAC 2 cut(s) 56, 88
BccI CCATC 1 cut(s) 113
BfmI CTRYAG 1 cut(s) 204
BfrI CTTAAG 1 cut(s) 101
BsaAI YACGTR 1 cut(s) 63
BsaXI ACNNNNNCTCC 2 cut(s) 98, 128
BspACI CCGC 1 cut(s) 43
BspMAI CTGCAG 1 cut(s) 208
BspTI CTTAAG 1 cut(s) 101
Bst4CI ACNGT 1 cut(s) 126
BstAFI CTTAAG 1 cut(s) 101
BstBAI YACGTR 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstSFI CTRYAG 1 cut(s) 204
CviJI RGCY 3 cut(s) 82, 172, 193
CviKI_1 RGCY 3 cut(s) 82, 172, 193
EciI GGCGGA 1 cut(s) 58
FaiI YATR 3 cut(s) 26, 87, 117
FalI AAGNNNNNCTT 2 cut(s) 95, 127
HindIII AAGCTT 2 cut(s) 80, 170
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 158, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpySE526I ACGT 1 cut(s) 62
LpnPI CCDG 1 cut(s) 146
MaeII ACGT 1 cut(s) 62
MboII GAAGA 1 cut(s) 64
MluCI AATT 4 cut(s) 4, 37, 53, 68
MnlI CCTC 2 cut(s) 106, 177
MseI TTAA 1 cut(s) 102
MspCI CTTAAG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 212
Ppu21I YACGTR 1 cut(s) 63
PsiI TTATAA 1 cut(s) 87
PstI CTGCAG 1 cut(s) 208
SaqAI TTAA 1 cut(s) 102
SetI ASST 5 cut(s) 65, 84, 98, 174, 195
SfcI CTRYAG 1 cut(s) 204
SgeI CNNG 8 cut(s) 73, 91, 109, 124, 146, 164, 173, 200
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 4 cut(s) 4, 37, 53, 68
SsiI CCGC 1 cut(s) 43
TaaI ACNGT 1 cut(s) 126
TaiI ACGT 1 cut(s) 65
TasI AATT 4 cut(s) 4, 37, 53, 68
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspDTI ATGAA 2 cut(s) 17, 156
Vha464I CTTAAG 1 cut(s) 101
XapI RAATTY 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.