Rmu_co8306773.1_g000001

Autophagy-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8306773.1
Physical Location & Seq
Forward (+)
1 .. 825
825 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8306773.1_g000001.1.cds

Sequence Viewer

Length: 218 bp
gtgtgctgccaaggtatttcagctcagaatggtcggtggccaaatttcacttgcaggaaggtctgcagcatattgttgcctttggcaagcggaagaacaccatcatgattgttggcatggatggaagcttctatcgatgccaatttgaccctgtgaatggaggagaaatgacgcagcttgaatatcataacttcttgaagccagaagaaactttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.3

Weight (kDa)

6.3

Isoelectric Point (pI)

41.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 90
AcoI YGGCCR 1 cut(s) 38
AcsI RAATTY 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 157
AgsI TTSAA 2 cut(s) 181, 198
AluBI AGCT 3 cut(s) 23, 128, 177
AluI AGCT 3 cut(s) 23, 128, 177
AoxI GGCC 1 cut(s) 38
ApeKI GCWGC 3 cut(s) 6, 66, 174
ApoI RAATTY 1 cut(s) 43
BalI TGGCCA 1 cut(s) 40
BbvI GCAGC 2 cut(s) 78, 186
BccI CCATC 2 cut(s) 109, 115
BfmI CTRYAG 1 cut(s) 64
BisI GCNGC 3 cut(s) 7, 67, 175
BlsI GCNGC 3 cut(s) 8, 68, 176
BmsI GCATC 1 cut(s) 127
Bsa29I ATCGAT 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 157
BseCI ATCGAT 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 10
BseGI GGATG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 176
BseXI GCAGC 2 cut(s) 78, 186
BshFI GGCC 1 cut(s) 40
BshVI ATCGAT 1 cut(s) 135
BslI CCNNNNNNNGG 1 cut(s) 157
BsnI GGCC 1 cut(s) 40
BspACI CCGC 1 cut(s) 90
BspANI GGCC 1 cut(s) 40
BspCNI CTCAG 1 cut(s) 37
BspDI ATCGAT 1 cut(s) 135
BspHI TCATGA 1 cut(s) 104
BspMAI CTGCAG 1 cut(s) 68
BssECI CCNNGG 1 cut(s) 10
BssT1I CCWWGG 1 cut(s) 10
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 64
BstV1I GCAGC 2 cut(s) 78, 186
Bsu15I ATCGAT 1 cut(s) 135
BsuRI GGCC 1 cut(s) 40
BsuTUI ATCGAT 1 cut(s) 135
BtsCI GGATG 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 88
CciI TCATGA 1 cut(s) 104
ClaI ATCGAT 1 cut(s) 135
CseI GACGC 1 cut(s) 180
CviAII CATG 2 cut(s) 105, 117
CviJI RGCY 5 cut(s) 23, 40, 128, 177, 201
CviKI_1 RGCY 5 cut(s) 23, 40, 128, 177, 201
DdeI CTNAG 1 cut(s) 24
EaeI YGGCCR 1 cut(s) 38
Eco130I CCWWGG 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 10
ErhI CCWWGG 1 cut(s) 10
FaeI CATG 2 cut(s) 108, 120
FaiI YATR 4 cut(s) 71, 106, 118, 188
FatI CATG 2 cut(s) 104, 116
Fnu4HI GCNGC 3 cut(s) 7, 67, 175
FokI GGATG 1 cut(s) 133
Fsp4HI GCNGC 3 cut(s) 7, 67, 175
GluI GCNGC 3 cut(s) 7, 67, 175
HaeIII GGCC 1 cut(s) 40
HgaI GACGC 1 cut(s) 180
Hin1II CATG 2 cut(s) 108, 120
HindIII AAGCTT 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 2 cut(s) 105, 195
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 54, 66
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 2 cut(s) 108, 120
LpnPI CCDG 2 cut(s) 40, 164
Lsp1109I GCAGC 2 cut(s) 78, 186
LweI GCATC 1 cut(s) 127
MboII GAAGA 2 cut(s) 105, 217
MlsI TGGCCA 1 cut(s) 40
MluCI AATT 2 cut(s) 43, 142
MluNI TGGCCA 1 cut(s) 40
MnlI CCTC 1 cut(s) 154
Mox20I TGGCCA 1 cut(s) 40
MscI TGGCCA 1 cut(s) 40
MslI CAYNNNNRTG 1 cut(s) 103
Msp20I TGGCCA 1 cut(s) 40
NlaIII CATG 2 cut(s) 108, 120
PagI TCATGA 1 cut(s) 104
PkrI GCNGC 3 cut(s) 8, 68, 176
PstI CTGCAG 1 cut(s) 68
RseI CAYNNNNRTG 1 cut(s) 103
SatI GCNGC 3 cut(s) 7, 67, 175
SetI ASST 5 cut(s) 16, 25, 63, 130, 179
SfaNI GCATC 1 cut(s) 127
SfcI CTRYAG 1 cut(s) 64
SmiMI CAYNNNNRTG 1 cut(s) 103
Sse9I AATT 2 cut(s) 43, 142
SsiI CCGC 1 cut(s) 90
StyI CCWWGG 1 cut(s) 10
TaqI TCGA 1 cut(s) 135
TasI AATT 2 cut(s) 43, 142
TseI GCWGC 3 cut(s) 6, 66, 174
XapI RAATTY 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.