Rmu_sc0010428.1_g000008

WD repeat domain phosphoinositide-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010428.1
Physical Location & Seq
Reverse (-)
33914 .. 34560
647 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010428.1_g000008.1.cds

Sequence Viewer

Length: 225 bp
atgaaaggtgttctgccaaggtatttcagctcagaatggtcagtggctaaatttcacttgcacgaaggtttggagtacattgttgcctttggccaccagaagaacactgttgtggttctaggcatggatggaagcttctatcgatgtgaatttgaccctgtcaatggaggagaaatgactcagcttgaatattataatttcttgaagccagaagaaaccttctga

Protein Analysis

74

Amino Acids

8.62

Weight (kDa)

5.18

Isoelectric Point (pI)

19.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 195
AcoI YGGCCR 1 cut(s) 91
AcsI RAATTY 2 cut(s) 50, 149
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 188, 205
AleI CACNNNNGTG 1 cut(s) 110
AluBI AGCT 3 cut(s) 30, 135, 184
AluI AGCT 3 cut(s) 30, 135, 184
AoxI GGCC 1 cut(s) 91
ApoI RAATTY 2 cut(s) 50, 149
BalI TGGCCA 1 cut(s) 93
BccI CCATC 1 cut(s) 122
BfaI CTAG 1 cut(s) 119
Bsa29I ATCGAT 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseCI ATCGAT 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 17
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 2 cut(s) 45, 194
BseRI GAGGAG 1 cut(s) 183
BshFI GGCC 1 cut(s) 93
BshVI ATCGAT 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 164
BsnI GGCC 1 cut(s) 93
BspANI GGCC 1 cut(s) 93
BspCNI CTCAG 2 cut(s) 44, 193
BspDI ATCGAT 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 17
BssT1I CCWWGG 1 cut(s) 17
Bst4CI ACNGT 1 cut(s) 109
BstDEI CTNAG 2 cut(s) 31, 180
BstF5I GGATG 1 cut(s) 133
Bsu15I ATCGAT 1 cut(s) 142
BsuRI GGCC 1 cut(s) 93
BsuTUI ATCGAT 1 cut(s) 142
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 2 cut(s) 48, 105
ClaI ATCGAT 1 cut(s) 142
Csp6I GTAC 1 cut(s) 76
CviAII CATG 1 cut(s) 124
CviJI RGCY 6 cut(s) 30, 47, 93, 135, 184, 208
CviKI_1 RGCY 6 cut(s) 30, 47, 93, 135, 184, 208
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 2 cut(s) 31, 180
EaeI YGGCCR 1 cut(s) 91
Eco130I CCWWGG 1 cut(s) 17
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
FaeI CATG 1 cut(s) 127
FaiI YATR 2 cut(s) 125, 195
FatI CATG 1 cut(s) 123
FokI GGATG 1 cut(s) 140
FspBI CTAG 1 cut(s) 119
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 1 cut(s) 127
HindIII AAGCTT 1 cut(s) 133
HinfI GANTC 1 cut(s) 178
Hpy188I TCNGA 2 cut(s) 34, 224
Hpy188III TCNNGA 1 cut(s) 202
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 61
HpyF3I CTNAG 2 cut(s) 31, 180
Hsp92II CATG 1 cut(s) 127
LpnPI CCDG 2 cut(s) 110, 171
MaeI CTAG 1 cut(s) 119
MboII GAAGA 2 cut(s) 112, 224
MlsI TGGCCA 1 cut(s) 93
MluCI AATT 3 cut(s) 50, 149, 196
MluNI TGGCCA 1 cut(s) 93
MlyI GAGTC 1 cut(s) 172
MnlI CCTC 1 cut(s) 161
Mox20I TGGCCA 1 cut(s) 93
MscI TGGCCA 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 110
Msp20I TGGCCA 1 cut(s) 93
NlaIII CATG 1 cut(s) 127
OliI CACNNNNGTG 1 cut(s) 110
PflFI GACNNNGTC 1 cut(s) 158
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
PsiI TTATAA 1 cut(s) 195
PsyI GACNNNGTC 1 cut(s) 158
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
RseI CAYNNNNRTG 1 cut(s) 110
SchI GAGTC 1 cut(s) 172
SetI ASST 7 cut(s) 10, 23, 32, 70, 137, 186, 221
SmiMI CAYNNNNRTG 1 cut(s) 110
Sse9I AATT 3 cut(s) 50, 149, 196
SspI AATATT 1 cut(s) 191
SspMI CTAG 1 cut(s) 119
StyI CCWWGG 1 cut(s) 17
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 142
TasI AATT 3 cut(s) 50, 149, 196
TatI WGTACW 1 cut(s) 75
TscAI CASTG 2 cut(s) 48, 112
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 48, 112
Tth111I GACNNNGTC 1 cut(s) 158
XapI RAATTY 2 cut(s) 50, 149
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.