Rroxscaffold_2G00089670

Regulator of chromosome condensation (RCC1) repeat

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
11595890 .. 11601096
5207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00089670.1

Sequence Viewer

Length: 225 bp
ATGACCGAAAGGAATGACTGCAATTCTAAGAAAGTATTCCTTAAGACGAGAAGAGGATTTGTTCGCATAGCCATGGAGGATGGCTATCCCTCGGTTTCAGTTTTCTGCTTTGGAGGAGCAAAAGCAGTTCATGTACCAACAAAAGCTGAATGCTTGGCTGGAATCACCATTAGGATGGAAGCTTTGGGATCAGAACACTCAATGGCTGTTATTGGTATAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.03

Weight (kDa)

8.99

Isoelectric Point (pI)

35.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DAGAT PF03982 8 - 42 1.7e-07 Diacylglycerol acyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 196
AfaI GTAC 1 cut(s) 135
AflII CTTAAG 1 cut(s) 41
AluBI AGCT 2 cut(s) 146, 182
AluI AGCT 2 cut(s) 146, 182
AlwI GGATC 1 cut(s) 196
Asp700I GAANNNNTTC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 157
BccI CCATC 2 cut(s) 74, 169
BfrI CTTAAG 1 cut(s) 41
BsaBI GATNNNNATC 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 72, 90
Bse8I GATNNNNATC 1 cut(s) 84
BseDI CCNNGG 2 cut(s) 72, 90
BseGI GGATG 2 cut(s) 85, 180
BseJI GATNNNNATC 1 cut(s) 84
BseRI GAGGAG 1 cut(s) 129
BsmI GAATGC 1 cut(s) 155
Bsp143I GATC 1 cut(s) 188
Bsp19I CCATGG 1 cut(s) 72
BspPI GGATC 1 cut(s) 196
BspTI CTTAAG 1 cut(s) 41
BssECI CCNNGG 2 cut(s) 72, 90
BssMI GATC 1 cut(s) 188
BssT1I CCWWGG 1 cut(s) 72
Bst6I CTCTTC 1 cut(s) 46
BstAFI CTTAAG 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 27
BstDSI CCRYGG 1 cut(s) 72
BstF5I GGATG 2 cut(s) 85, 180
BstKTI GATC 1 cut(s) 191
BstMBI GATC 1 cut(s) 188
BstXI CCANNNNNNTGG 1 cut(s) 175
BtgI CCRYGG 1 cut(s) 72
BtsCI GGATG 2 cut(s) 85, 180
Csp6I GTAC 1 cut(s) 134
CviAII CATG 2 cut(s) 73, 131
CviJI RGCY 6 cut(s) 71, 84, 146, 158, 182, 206
CviKI_1 RGCY 6 cut(s) 71, 84, 146, 158, 182, 206
CviQI GTAC 1 cut(s) 134
DdeI CTNAG 1 cut(s) 27
DpnI GATC 1 cut(s) 190
DpnII GATC 1 cut(s) 188
Eam1104I CTCTTC 1 cut(s) 46
EarI CTCTTC 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 72
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 2 cut(s) 76, 134
FaiI YATR 4 cut(s) 68, 74, 132, 218
FalI AAGNNNNNCTT 2 cut(s) 24, 56
FatI CATG 2 cut(s) 72, 130
FokI GGATG 2 cut(s) 92, 187
Hin1II CATG 2 cut(s) 76, 134
HindIII AAGCTT 1 cut(s) 180
HinfI GANTC 1 cut(s) 162
HphI GGTGA 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 193
HpyCH4V TGCA 1 cut(s) 21
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 2 cut(s) 76, 134
Kzo9I GATC 1 cut(s) 188
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 1 cut(s) 144
MalI GATC 1 cut(s) 190
MboI GATC 1 cut(s) 188
MboII GAAGA 1 cut(s) 63
MluCI AATT 1 cut(s) 22
MnlI CCTC 4 cut(s) 47, 70, 100, 107
MroXI GAANNNNTTC 1 cut(s) 35
MseI TTAA 2 cut(s) 42, 223
MslI CAYNNNNRTG 2 cut(s) 71, 173
MspCI CTTAAG 1 cut(s) 41
Mva1269I GAATGC 1 cut(s) 155
NcoI CCATGG 1 cut(s) 72
NdeII GATC 1 cut(s) 188
NlaIII CATG 2 cut(s) 76, 134
PctI GAATGC 1 cut(s) 155
PdmI GAANNNNTTC 1 cut(s) 35
PfeI GAWTC 1 cut(s) 162
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
RseI CAYNNNNRTG 2 cut(s) 71, 173
SaqAI TTAA 2 cut(s) 42, 223
Sau3AI GATC 1 cut(s) 188
SetI ASST 2 cut(s) 148, 184
SgeI CNNG 6 cut(s) 60, 85, 103, 143, 166, 171
SmiMI CAYNNNNRTG 2 cut(s) 71, 173
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 1 cut(s) 22
StyI CCWWGG 1 cut(s) 72
TaqII GACCGA 1 cut(s) 20
TasI AATT 1 cut(s) 22
TfiI GAWTC 1 cut(s) 162
Tru1I TTAA 2 cut(s) 42, 223
Tru9I TTAA 2 cut(s) 42, 223
TspDTI ATGAA 1 cut(s) 119
Vha464I CTTAAG 1 cut(s) 41
XmnI GAANNNNTTC 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.