Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8323625.1

Orthogroup ID

OG0012736

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 198

Gene Structure 198 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8323625.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 159 bp

atggaatcttcagacaaggtggtggagactgtgatagtaggaaactatgtagaaatggaggctgatgggaaaggcaaggacttcaagtccaagctttccaagttcttctgggatggtggctccacttatgatgcttggttcagctgtgcttcaaatcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003002 GO:0003006 GO:0003333 GO:0003674 GO:0005215 GO:0005342 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006820 GO:0006865 GO:0007275 GO:0007389 GO:0008150 GO:0008509 GO:0008514 GO:0009605 GO:0009607 GO:0009624 GO:0009653 GO:0009790 GO:0009791 GO:0009793 GO:0009965 GO:0010016 GO:0010051 GO:0010154 GO:0010588 GO:0015075 GO:0015171 GO:0015318 GO:0015711 GO:0015849 GO:0016020 GO:0022414 GO:0022622 GO:0022857 GO:0032501 GO:0032502 GO:0034220 GO:0043207 GO:0044464 GO:0046942 GO:0046943 GO:0048316 GO:0048364 GO:0048366 GO:0048367 GO:0048598 GO:0048608 GO:0048731 GO:0048825 GO:0048826 GO:0048827 GO:0048829 GO:0048856 GO:0050896 GO:0051179 GO:0051234 GO:0051704 GO:0051707 GO:0055085 GO:0061458 GO:0071702 GO:0071705 GO:0071944 GO:0090698 GO:0098656 GO:0099402 GO:1903825 GO:1905039 GO:1905392

KEGG Pathways

Metabolic & Signaling

ko04075 map04075

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

53

Amino Acids

5.92

Weight (kDa)

4.56

Isoelectric Point (pI)

8.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012736)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21050
fragaria_vesca	FvH4_2g01570
malus_domestica	MD05G1118600.v1.1 MD10G1121700.v1.1
prunus_persica	Prupe.8G163100_v2.0.a1
pyrus_communis	pycom05g11270 pycom10g10470
rosa_chinensis	RchiOBHm_Chr6g0244221
rosa_laevigata	RLG00000015371
rosa_multiflora	Rmu_co8323625.1_g000001 Rmu_ssc0000406.1_g000001
rosa_roxburghii	Rroxscaffold_7G00215910
rosa_rugosa	Rorug05G0507900
rosa_samantha	Rh6AG022700 Rh6BG018500 Rh6CG015400 Rh6DG016500
rosa_wichuraiana	Rw6G001880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	85, 153
AhdI	GACNNNNNGTC	1 cut(s)	85
AluBI	AGCT	2 cut(s)	94, 144
AluI	AGCT	2 cut(s)	94, 144
Alw26I	GTCTC	1 cut(s)	20
BccI	CCATC	2 cut(s)	59, 107
BcoDI	GTCTC	1 cut(s)	20
BmeRI	GACNNNNNGTC	1 cut(s)	85
BmiI	GGNNCC	1 cut(s)	121
BmsI	GCATC	1 cut(s)	121
BseGI	GGATG	1 cut(s)	118
BsmAI	GTCTC	1 cut(s)	20
BspLI	GGNNCC	1 cut(s)	121
Bst4CI	ACNGT	1 cut(s)	31
BstF5I	GGATG	1 cut(s)	118
BstMAI	GTCTC	1 cut(s)	20
BtsCI	GGATG	1 cut(s)	118
CviJI	RGCY	4 cut(s)	62, 94, 120, 144
CviKI_1	RGCY	4 cut(s)	62, 94, 120, 144
DriI	GACNNNNNGTC	1 cut(s)	85
Eam1105I	GACNNNNNGTC	1 cut(s)	85
FaiI	YATR	2 cut(s)	48, 129
FokI	GGATG	1 cut(s)	125
HindIII	AAGCTT	1 cut(s)	92
HinfI	GANTC	1 cut(s)	5
Hpy188I	TCNGA	1 cut(s)	13
HpyCH4III	ACNGT	1 cut(s)	31
LmnI	GCTCC	1 cut(s)	125
LpnPI	CCDG	1 cut(s)	94
LweI	GCATC	1 cut(s)	121
MboII	GAAGA	1 cut(s)	97
MnlI	CCTC	1 cut(s)	52
MspA1I	CMGCKG	1 cut(s)	144
NlaIV	GGNNCC	1 cut(s)	121
PfeI	GAWTC	1 cut(s)	5
PspN4I	GGNNCC	1 cut(s)	121
PvuII	CAGCTG	1 cut(s)	144
SetI	ASST	3 cut(s)	21, 96, 146
SfaNI	GCATC	1 cut(s)	121
SgeI	CNNG	7 cut(s)	28, 88, 97, 103, 112, 121, 147
TaaI	ACNGT	1 cut(s)	31
TfiI	GAWTC	1 cut(s)	5

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.