Rmu_co8329573.1_g000001

post-GPI attachment to proteins factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8329573.1
Physical Location & Seq
Reverse (-)
351 .. 611
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8329573.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atgggcgttgctcatcttcttatatgggcagtttgggctggtactacccgtcatctatcacgctggaagttgtgggtggttgttgtgggaggaggccttaccatgctcttggagatatatgacttcccaccttaccgaggatttatagatgctcatgcaattgcaaacggtatcaccatccctctcacatacctttggtggagttttgtcaaggatgacgccgagtttatgacagcagctctccttaagaaagcaaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.76

Weight (kDa)

9.16

Isoelectric Point (pI)

20.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 219
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 137
AflII CTTAAG 1 cut(s) 245
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
AoxI GGCC 1 cut(s) 94
ApeKI GCWGC 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 166
BbvI GCAGC 1 cut(s) 248
BccI CCATC 1 cut(s) 185
BfrI CTTAAG 1 cut(s) 245
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
BmsI GCATC 1 cut(s) 139
BsaHI GRCGYC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 2 cut(s) 177, 220
BseLI CCNNNNNNNGG 1 cut(s) 137
BseRI GAGGAG 1 cut(s) 105
BseXI GCAGC 1 cut(s) 248
BshFI GGCC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 137
BsnI GGCC 1 cut(s) 96
BspANI GGCC 1 cut(s) 96
BspTI CTTAAG 1 cut(s) 245
BssECI CCNNGG 1 cut(s) 136
BssNI GRCGYC 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 170
BstACI GRCGYC 1 cut(s) 219
BstAFI CTTAAG 1 cut(s) 245
BstENI CCTNNNNNAGG 1 cut(s) 135
BstF5I GGATG 2 cut(s) 177, 220
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstV1I GCAGC 1 cut(s) 248
BstXI CCANNNNNNTGG 1 cut(s) 109
BsuRI GGCC 1 cut(s) 96
BtsCI GGATG 2 cut(s) 177, 220
CseI GACGC 1 cut(s) 227
Csp6I GTAC 1 cut(s) 42
CviAII CATG 2 cut(s) 103, 155
CviJI RGCY 3 cut(s) 38, 96, 239
CviKI_1 RGCY 3 cut(s) 38, 96, 239
CviQI GTAC 1 cut(s) 42
Eco147I AGGCCT 1 cut(s) 96
EcoNI CCTNNNNNAGG 1 cut(s) 135
FaeI CATG 2 cut(s) 106, 158
FaiI YATR 9 cut(s) 23, 25, 104, 118, 120, 146, 156, 190, 230
FatI CATG 2 cut(s) 102, 154
Fnu4HI GCNGC 1 cut(s) 237
FokI GGATG 2 cut(s) 164, 227
Fsp4HI GCNGC 1 cut(s) 237
GluI GCNGC 1 cut(s) 237
HaeIII GGCC 1 cut(s) 96
HgaI GACGC 1 cut(s) 227
Hin1I GRCGYC 1 cut(s) 219
Hin1II CATG 2 cut(s) 106, 158
HphI GGTGA 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4V TGCA 2 cut(s) 158, 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
Hsp92I GRCGYC 1 cut(s) 219
Hsp92II CATG 2 cut(s) 106, 158
LpnPI CCDG 2 cut(s) 24, 49
Lsp1109I GCAGC 1 cut(s) 248
LweI GCATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 8
MfeI CAATTG 1 cut(s) 159
MluCI AATT 1 cut(s) 159
MnlI CCTC 4 cut(s) 83, 86, 131, 192
MseI TTAA 1 cut(s) 246
MspCI CTTAAG 1 cut(s) 245
MunI CAATTG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 35
NlaIII CATG 2 cut(s) 106, 158
NmeAIII GCCGAG 1 cut(s) 247
PceI AGGCCT 1 cut(s) 96
PkrI GCNGC 1 cut(s) 238
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 246
SatI GCNGC 1 cut(s) 237
SetI ASST 3 cut(s) 133, 195, 241
SfaNI GCATC 1 cut(s) 139
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
Sse9I AATT 1 cut(s) 159
SseBI AGGCCT 1 cut(s) 96
StuI AGGCCT 1 cut(s) 96
TaaI ACNGT 1 cut(s) 170
TasI AATT 1 cut(s) 159
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
TseI GCWGC 1 cut(s) 236
Vha464I CTTAAG 1 cut(s) 245
XagI CCTNNNNNAGG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.