Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8377769.1

Orthogroup ID

OG0001664

Physical Location & Seq

Genomic Coordinates Reverse (-)

38 .. 982

Gene Structure 945 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8377769.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 624 bp

ctgcaactgcaacatcttgaggatttggttcttgaaggatgccttggaattgatgatgatggccttgttagccttaagcatagttgcagctcgctcaagatgcttaatttgtcgaaatgtcagaatgttagtcatgtgggtttgtcttctctgacaaatggtgctgacaacctagagcagcttatcctatcatatggtccttctgtcaccactgacctggggaaatgcctccttaattattcgagattgaaatcgattagactagatggttgtttggtcacatgttctgggactaaagcaataggaagttggtgtgcctcgttgagagagctgagcttaagtaaatgcactggagtgacagatgagtgcctctccttccttgtgcaagcgcataggcaattgctgaaactagacatcatctgctgccgcaaaataacttcggtcgctatagattgcataacaaagtcttgcatattcctcacttccctgaggatggaatcctgtagcctggtttctaaagacgcattcctgttgattggacagcgttgccaattcttggaggaattggatgtcacagataacgaaattgatgatgaaggttttgatttgaacttaacattctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_6

Protein Analysis

207

Amino Acids

22.66

Weight (kDa)

4.94

Isoelectric Point (pI)

30.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001664)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G01720
fragaria_vesca	FvH4_3g39860 FvH4_3g39860 FvH4_3g39860 FvH4_3g39860 FvH4_3g39860 FvH4_3g39860 FvH4_3g39860 FvH4_6g10500 FvH4_6g10500 FvH4_6g10500 FvH4_6g10500 FvH4_6g10500
malus_domestica	MD04G1167900.v1.1 MD11G1060100.v1.1 MD12G1181200.v1.1
prunus_persica	Prupe.6G046600_v2.0.a1 Prupe.6G046600_v2.0.a1 Prupe.6G046600_v2.0.a1 Prupe.6G046600_v2.0.a1 Prupe.6G286100_v2.0.a1 Prupe.6G286100_v2.0.a1
pyrus_communis	pycom11g04970
rosa_chinensis	RchiOBHm_Chr3g0461461 RchiOBHm_Chr5g0071821
rosa_laevigata	RLG00000024932 RLG00000036254
rosa_multiflora	Rmu_co8377769.1_g000001 Rmu_sc0002677.1_g000006 Rmu_sc0008190.1_g000001 Rmu_sc0015603.1_g000012 Rmu_ssc0000127.1_g000066
rosa_roxburghii	Rroxscaffold_1G00009310 Rroxscaffold_6G00418260 Rroxscaffold_6G00418590
rosa_rugosa	Rorug03G0050900 Rorug05G0414800 Rorug05G0414900 Rorug05G0415000
rosa_samantha	Rh3AG108700 Rh3BG112500 Rh3CG114100 Rh3DG114200 Rh5AG471100 Rh5BG490800 Rh5CG514800 Rh5DG502300
rosa_wichuraiana	Rw3G009240 Rw5G043780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	556
AciI	CCGC	1 cut(s)	427
AfiI	CCNNNNNNNGG	2 cut(s)	493, 556
AflII	CTTAAG	2 cut(s)	74, 337
AflIII	ACRYGT	1 cut(s)	281
AgsI	TTSAA	3 cut(s)	35, 250, 610
AjnI	CCWGG	2 cut(s)	216, 507
AjuI	GAANNNNNNNTTGG	2 cut(s)	27, 59
AleI	CACNNNNGTG	1 cut(s)	353
AluBI	AGCT	4 cut(s)	90, 181, 331, 336
AluI	AGCT	4 cut(s)	90, 181, 331, 336
AoxI	GGCC	1 cut(s)	61
ApeKI	GCWGC	3 cut(s)	87, 178, 423
AspLEI	GCGC	1 cut(s)	391
AspS9I	GGNCC	1 cut(s)	197
AsuHPI	GGTGA	1 cut(s)	199
AvaII	GGWCC	1 cut(s)	197
AxyI	CCTNAGG	1 cut(s)	488
BbsI	GAAGAC	1 cut(s)	138
BbvI	GCAGC	3 cut(s)	99, 190, 410
BccI	CCATC	3 cut(s)	53, 260, 487
BciT130I	CCWGG	2 cut(s)	218, 509
BfaI	CTAG	3 cut(s)	173, 263, 410
BfmI	CTRYAG	2 cut(s)	447, 502
BfrI	CTTAAG	2 cut(s)	74, 337
BisI	GCNGC	4 cut(s)	88, 179, 424, 427
BlpI	GCTNAGC	1 cut(s)	332
BlsI	GCNGC	4 cut(s)	89, 180, 425, 428
Bme1390I	CCNGG	2 cut(s)	218, 509
Bme18I	GGWCC	1 cut(s)	197
BmgT120I	GGNCC	1 cut(s)	197
BmrFI	CCNGG	2 cut(s)	218, 509
BmsI	GCATC	2 cut(s)	29, 90
BpiI	GAAGAC	1 cut(s)	138
BplI	GAGNNNNNCTC	2 cut(s)	356, 388
BpmI	CTGGAG	1 cut(s)	372
Bpu1102I	GCTNAGC	1 cut(s)	332
BpuEI	CTTGAG	2 cut(s)	38, 80
Bsa29I	ATCGAT	1 cut(s)	254
BsaBI	GATNNNNATC	1 cut(s)	250
BsaJI	CCNNGG	2 cut(s)	43, 217
Bsc4I	CCNNNNNNNGG	2 cut(s)	493, 556
Bse1I	ACTGG	1 cut(s)	355
Bse21I	CCTNAGG	1 cut(s)	488
Bse8I	GATNNNNATC	1 cut(s)	250
BseBI	CCWGG	2 cut(s)	218, 509
BseCI	ATCGAT	1 cut(s)	254
BseDI	CCNNGG	2 cut(s)	43, 217
BseGI	GGATG	3 cut(s)	44, 498, 574
BseJI	GATNNNNATC	1 cut(s)	250
BseLI	CCNNNNNNNGG	2 cut(s)	493, 556
BseMII	CTCAG	2 cut(s)	323, 479
BseNI	ACTGG	1 cut(s)	355
BseXI	GCAGC	3 cut(s)	99, 190, 410
Bsh1285I	CGRYCG	1 cut(s)	444
BshFI	GGCC	1 cut(s)	63
BshVI	ATCGAT	1 cut(s)	254
BsiEI	CGRYCG	1 cut(s)	444
BslFI	GGGAC	1 cut(s)	304
BslI	CCNNNNNNNGG	2 cut(s)	493, 556
BsmFI	GGGAC	1 cut(s)	304
BsmI	GAATGC	1 cut(s)	524
BsnI	GGCC	1 cut(s)	63
Bsp1720I	GCTNAGC	1 cut(s)	332
BspACI	CCGC	1 cut(s)	427
BspANI	GGCC	1 cut(s)	63
BspCNI	CTCAG	2 cut(s)	324, 480
BspDI	ATCGAT	1 cut(s)	254
BspTI	CTTAAG	2 cut(s)	74, 337
BsrI	ACTGG	1 cut(s)	355
BssECI	CCNNGG	2 cut(s)	43, 217
BssT1I	CCWWGG	1 cut(s)	43
Bst2UI	CCWGG	2 cut(s)	218, 509
BstAFI	CTTAAG	2 cut(s)	74, 337
BstC8I	GCNNGC	2 cut(s)	92, 387
BstDEI	CTNAG	2 cut(s)	332, 488
BstF5I	GGATG	3 cut(s)	44, 498, 574
BstHHI	GCGC	1 cut(s)	391
BstMCI	CGRYCG	1 cut(s)	444
BstMWI	GCNNNNNNNGC	2 cut(s)	69, 100
BstNI	CCWGG	2 cut(s)	218, 509
BstNSI	RCATGY	1 cut(s)	285
BstSCI	CCNGG	2 cut(s)	216, 507
BstSFI	CTRYAG	2 cut(s)	447, 502
BstV1I	GCAGC	3 cut(s)	99, 190, 410
BstV2I	GAAGAC	1 cut(s)	138
BstXI	CCANNNNNNTGG	1 cut(s)	217
Bsu15I	ATCGAT	1 cut(s)	254
Bsu36I	CCTNAGG	1 cut(s)	488
BsuRI	GGCC	1 cut(s)	63
BsuTUI	ATCGAT	1 cut(s)	254
BtsCI	GGATG	3 cut(s)	44, 498, 574
BtsIMutI	CAGTG	2 cut(s)	210, 348
Cac8I	GCNNGC	2 cut(s)	92, 387
CfoI	GCGC	1 cut(s)	391
Cfr13I	GGNCC	1 cut(s)	197
ClaI	ATCGAT	1 cut(s)	254
CseI	GACGC	1 cut(s)	530
CviAII	CATG	2 cut(s)	134, 282
CviJI	RGCY	7 cut(s)	63, 72, 90, 181, 331, 336, 507
CviKI_1	RGCY	7 cut(s)	63, 72, 90, 181, 331, 336, 507
DdeI	CTNAG	2 cut(s)	332, 488
Eco130I	CCWWGG	1 cut(s)	43
Eco47I	GGWCC	1 cut(s)	197
Eco81I	CCTNAGG	1 cut(s)	488
EcoRII	CCWGG	2 cut(s)	216, 507
EcoT14I	CCWWGG	1 cut(s)	43
ErhI	CCWWGG	1 cut(s)	43
FaeI	CATG	2 cut(s)	137, 285
FaiI	YATR	9 cut(s)	81, 135, 193, 195, 283, 393, 449, 458, 473
FalI	AAGNNNNNCTT	2 cut(s)	27, 59
FaqI	GGGAC	1 cut(s)	304
FatI	CATG	2 cut(s)	133, 281
FauNDI	CATATG	1 cut(s)	193
Fnu4HI	GCNGC	4 cut(s)	88, 179, 424, 427
FokI	GGATG	3 cut(s)	51, 505, 581
Fsp4HI	GCNGC	4 cut(s)	88, 179, 424, 427
FspBI	CTAG	3 cut(s)	173, 263, 410
GlaI	GCGC	1 cut(s)	390
GluI	GCNGC	4 cut(s)	88, 179, 424, 427
GsuI	CTGGAG	1 cut(s)	372
HaeIII	GGCC	1 cut(s)	63
HgaI	GACGC	1 cut(s)	530
HhaI	GCGC	1 cut(s)	391
Hin1II	CATG	2 cut(s)	137, 285
Hin6I	GCGC	1 cut(s)	389
HinP1I	GCGC	1 cut(s)	389
HinfI	GANTC	1 cut(s)	497
HphI	GGTGA	1 cut(s)	199
Hpy188I	TCNGA	2 cut(s)	123, 153
Hpy188III	TCNNGA	4 cut(s)	17, 32, 97, 243
HpyAV	CCTTC	4 cut(s)	29, 210, 385, 590
HpyCH4V	TGCA	7 cut(s)	4, 10, 87, 348, 385, 456, 471
HpyF10VI	GCNNNNNNNGC	2 cut(s)	69, 100
HpyF3I	CTNAG	2 cut(s)	332, 488
Hsp92II	CATG	2 cut(s)	137, 285
HspAI	GCGC	1 cut(s)	389
LpnPI	CCDG	9 cut(s)	203, 230, 273, 336, 494, 500, 514, 521, 542
Lsp1109I	GCAGC	3 cut(s)	99, 190, 410
LweI	GCATC	2 cut(s)	29, 90
MaeI	CTAG	3 cut(s)	173, 263, 410
MaeIII	GTNAC	4 cut(s)	205, 277, 355, 571
MboII	GAAGA	1 cut(s)	138
MfeI	CAATTG	1 cut(s)	398
MluCI	AATT	7 cut(s)	48, 106, 235, 398, 551, 563, 585
MnlI	CCTC	7 cut(s)	13, 239, 328, 380, 483, 488, 553
MseI	TTAA	5 cut(s)	75, 105, 234, 338, 614
MslI	CAYNNNNRTG	1 cut(s)	353
MspCI	CTTAAG	2 cut(s)	74, 337
MspR9I	CCNGG	2 cut(s)	218, 509
MunI	CAATTG	1 cut(s)	398
Mva1269I	GAATGC	1 cut(s)	524
MvaI	CCWGG	2 cut(s)	218, 509
MwoI	GCNNNNNNNGC	2 cut(s)	69, 100
NdeI	CATATG	1 cut(s)	193
NlaIII	CATG	2 cut(s)	137, 285
NmuCI	GTSAC	4 cut(s)	205, 277, 355, 571
NspI	RCATGY	1 cut(s)	285
OliI	CACNNNNGTG	1 cut(s)	353
PciI	ACATGT	1 cut(s)	281
PctI	GAATGC	1 cut(s)	524
PfeI	GAWTC	1 cut(s)	497
PflMI	CCANNNNNTGG	1 cut(s)	556
PkrI	GCNGC	4 cut(s)	89, 180, 425, 428
PscI	ACATGT	1 cut(s)	281
Psp6I	CCWGG	2 cut(s)	216, 507
PspGI	CCWGG	2 cut(s)	216, 507
PspPI	GGNCC	1 cut(s)	197
RseI	CAYNNNNRTG	1 cut(s)	353
SaqAI	TTAA	5 cut(s)	75, 105, 234, 338, 614
SatI	GCNGC	4 cut(s)	88, 179, 424, 427
Sau96I	GGNCC	1 cut(s)	197
ScrFI	CCNGG	2 cut(s)	218, 509
SetI	ASST	7 cut(s)	92, 174, 183, 219, 333, 338, 601
SfaNI	GCATC	2 cut(s)	29, 90
SfcI	CTRYAG	2 cut(s)	447, 502
SinI	GGWCC	1 cut(s)	197
SmiMI	CAYNNNNRTG	1 cut(s)	353
SmlI	CTYRAG	4 cut(s)	17, 74, 95, 337
SmoI	CTYRAG	4 cut(s)	17, 74, 95, 337
Sse9I	AATT	7 cut(s)	48, 106, 235, 398, 551, 563, 585
SsiI	CCGC	1 cut(s)	427
SspMI	CTAG	3 cut(s)	173, 263, 410
StyD4I	CCNGG	2 cut(s)	216, 507
StyI	CCWWGG	1 cut(s)	43
TaqI	TCGA	3 cut(s)	113, 242, 254
TaqII	GACCGA	1 cut(s)	430
TasI	AATT	7 cut(s)	48, 106, 235, 398, 551, 563, 585
TauI	GCSGC	1 cut(s)	429
TfiI	GAWTC	1 cut(s)	497
Tru1I	TTAA	5 cut(s)	75, 105, 234, 338, 614
Tru9I	TTAA	5 cut(s)	75, 105, 234, 338, 614
TscAI	CASTG	2 cut(s)	217, 355
TseFI	GTSAC	4 cut(s)	205, 277, 355, 571
TseI	GCWGC	3 cut(s)	87, 178, 423
Tsp45I	GTSAC	4 cut(s)	205, 277, 355, 571
TspDTI	ATGAA	1 cut(s)	609
TspRI	CASTG	2 cut(s)	217, 355
Van91I	CCANNNNNTGG	1 cut(s)	556
Vha464I	CTTAAG	2 cut(s)	74, 337
VpaK11BI	GGWCC	1 cut(s)	197
XceI	RCATGY	1 cut(s)	285
XspI	CTAG	3 cut(s)	173, 263, 410

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.