Rmu_co8396877.1_g000001

Belongs to the glyceraldehyde-3-phosphate dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8396877.1
Physical Location & Seq
Forward (+)
83 .. 1214
1132 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8396877.1_g000001.1.cds

Sequence Viewer

Length: 585 bp
atggcctcccacgcagctctagcttcttcaagaatcccagccaacaccaggcttccctccaagacctcccactcttttcccgctcaatgcttctccaagaggctggaagttgctgaattctctggcttgagatccagttcatgtttgacctatgcaaccaatggtagacaggcatcattctttgatgctgtggctgctcaactcactcccaagacttcaggatcagctcctgttaagggagaaacggtggccaaattgaaggtggctatcaacggatttggacggattggcaggaactttctccgatgctggcatggccggaaggattcaccccttgaggtcattgttgtcaatgacagtggtggtgtcaagaatgcttcccacttgctgaaatatgattctatgctgggtactttcaaagcagatataaaaatagtggacaatgaaactatcagtgttgatggtaagcctgtcaaggttgtctctaacagagatcccttgaagcttccatgggctgagatgggcattgacattgttattgaggtaaatgactgctatacttggatcactacaaagaaaatataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

194

Amino Acids

21.05

Weight (kDa)

9.54

Isoelectric Point (pI)

29.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 83
AccI GTMKAC 1 cut(s) 166
AciI CCGC 1 cut(s) 81
AclWI GGATC 4 cut(s) 126, 229, 488, 572
AcoI YGGCCR 2 cut(s) 249, 316
AcsI RAATTY 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 201
AfaI GTAC 1 cut(s) 412
AfiI CCNNNNNNNGG 2 cut(s) 48, 236
AgsI TTSAA 4 cut(s) 30, 259, 418, 502
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 4 cut(s) 17, 23, 227, 505
AluI AGCT 4 cut(s) 17, 23, 227, 505
Alw26I GTCTC 1 cut(s) 487
AlwI GGATC 4 cut(s) 126, 229, 488, 572
AlwNI CAGNNNCTG 1 cut(s) 230
AoxI GGCC 3 cut(s) 3, 249, 316
ApeKI GCWGC 2 cut(s) 14, 194
ApoI RAATTY 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 321
BalI TGGCCA 1 cut(s) 251
BbvI GCAGC 2 cut(s) 26, 181
BccI CCATC 2 cut(s) 455, 514
BciT130I CCWGG 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 487
BfaI CTAG 1 cut(s) 20
BisI GCNGC 2 cut(s) 15, 195
BlsI GCNGC 2 cut(s) 16, 196
Bme1390I CCNGG 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 49
BmsI GCATC 3 cut(s) 175, 182, 296
BpuEI CTTGAG 2 cut(s) 148, 356
BsaJI CCNNGG 1 cut(s) 509
BsaXI ACNNNNNCTCC 2 cut(s) 231, 261
Bsc4I CCNNNNNNNGG 2 cut(s) 48, 236
Bse1I ACTGG 1 cut(s) 135
BseBI CCWGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 509
BseLI CCNNNNNNNGG 2 cut(s) 48, 236
BseMII CTCAG 1 cut(s) 507
BseNI ACTGG 1 cut(s) 135
BseXI GCAGC 2 cut(s) 26, 181
BseYI CCCAGC 2 cut(s) 37, 406
BshFI GGCC 3 cut(s) 5, 251, 318
BsiSI CCGG 1 cut(s) 319
BslI CCNNNNNNNGG 2 cut(s) 48, 236
BsmAI GTCTC 1 cut(s) 487
BsmI GAATGC 1 cut(s) 379
BsnI GGCC 3 cut(s) 5, 251, 318
Bsp143I GATC 4 cut(s) 131, 221, 493, 564
Bsp19I CCATGG 1 cut(s) 509
BspACI CCGC 1 cut(s) 81
BspANI GGCC 3 cut(s) 5, 251, 318
BspCNI CTCAG 1 cut(s) 508
BspPI GGATC 4 cut(s) 126, 229, 488, 572
BsrBI CCGCTC 1 cut(s) 83
BsrI ACTGG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 509
BssMI GATC 4 cut(s) 131, 221, 493, 564
BssT1I CCWWGG 1 cut(s) 509
Bst2UI CCWGG 1 cut(s) 49
Bst4CI ACNGT 2 cut(s) 247, 359
BstC8I GCNNGC 1 cut(s) 311
BstDEI CTNAG 1 cut(s) 516
BstDSI CCRYGG 1 cut(s) 509
BstKTI GATC 4 cut(s) 134, 224, 496, 567
BstMAI GTCTC 1 cut(s) 487
BstMBI GATC 4 cut(s) 131, 221, 493, 564
BstMWI GCNNNNNNNGC 4 cut(s) 11, 20, 194, 315
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
BstV1I GCAGC 2 cut(s) 26, 181
BstX2I RGATCY 2 cut(s) 131, 493
BstXI CCANNNNNNTGG 1 cut(s) 103
BstYI RGATCY 2 cut(s) 131, 493
BsuRI GGCC 3 cut(s) 5, 251, 318
BtgI CCRYGG 1 cut(s) 509
BtsIMutI CAGTG 2 cut(s) 364, 460
Cac8I GCNNGC 1 cut(s) 311
CaiI CAGNNNCTG 1 cut(s) 230
Csp6I GTAC 1 cut(s) 411
CspCI CAANNNNNGTGG 2 cut(s) 340, 375
CviAII CATG 3 cut(s) 141, 314, 510
CviQI GTAC 1 cut(s) 411
DdeI CTNAG 1 cut(s) 516
DpnI GATC 4 cut(s) 133, 223, 495, 566
DpnII GATC 4 cut(s) 131, 221, 493, 564
EaeI YGGCCR 2 cut(s) 249, 316
Eco130I CCWWGG 1 cut(s) 509
Eco57I CTGAAG 1 cut(s) 201
EcoRI GAATTC 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 47
EcoT14I CCWWGG 1 cut(s) 509
ErhI CCWWGG 1 cut(s) 509
FaeI CATG 3 cut(s) 144, 317, 513
FaiI YATR 9 cut(s) 142, 153, 315, 396, 404, 428, 511, 558, 583
FatI CATG 3 cut(s) 140, 313, 509
FauI CCCGC 1 cut(s) 88
FblI GTMKAC 1 cut(s) 166
Fnu4HI GCNGC 2 cut(s) 15, 195
Fsp4HI GCNGC 2 cut(s) 15, 195
FspBI CTAG 1 cut(s) 20
GluI GCNGC 2 cut(s) 15, 195
GsaI CCCAGC 2 cut(s) 41, 410
HaeIII GGCC 3 cut(s) 5, 251, 318
HapII CCGG 1 cut(s) 319
Hin1II CATG 3 cut(s) 144, 317, 513
HindIII AAGCTT 1 cut(s) 503
HinfI GANTC 3 cut(s) 33, 326, 398
HpaII CCGG 1 cut(s) 319
HphI GGTGA 1 cut(s) 321
Hpy166II GTNNAC 2 cut(s) 167, 439
Hpy188I TCNGA 1 cut(s) 305
Hpy188III TCNNGA 3 cut(s) 30, 219, 370
Hpy8I GTNNAC 2 cut(s) 167, 439
HpyAV CCTTC 2 cut(s) 253, 316
HpyCH4III ACNGT 2 cut(s) 247, 359
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 4 cut(s) 11, 20, 194, 315
HpyF3I CTNAG 1 cut(s) 516
Hsp92II CATG 3 cut(s) 144, 317, 513
Kzo9I GATC 4 cut(s) 131, 221, 493, 564
LmnI GCTCC 1 cut(s) 232
Lsp1109I GCAGC 2 cut(s) 26, 181
LweI GCATC 3 cut(s) 175, 182, 296
MaeI CTAG 1 cut(s) 20
MalI GATC 4 cut(s) 133, 223, 495, 566
MbiI CCGCTC 1 cut(s) 83
MboI GATC 4 cut(s) 131, 221, 493, 564
MboII GAAGA 1 cut(s) 18
MflI RGATCY 2 cut(s) 131, 493
MlsI TGGCCA 1 cut(s) 251
MluCI AATT 2 cut(s) 116, 254
MluNI TGGCCA 1 cut(s) 251
MnlI CCTC 6 cut(s) 16, 67, 76, 93, 331, 535
Mox20I TGGCCA 1 cut(s) 251
MscI TGGCCA 1 cut(s) 251
MseI TTAA 1 cut(s) 234
Msp20I TGGCCA 1 cut(s) 251
MspI CCGG 1 cut(s) 319
MspR9I CCNGG 1 cut(s) 49
Mva1269I GAATGC 1 cut(s) 379
MvaI CCWGG 1 cut(s) 49
MwoI GCNNNNNNNGC 4 cut(s) 11, 20, 194, 315
NcoI CCATGG 1 cut(s) 509
NdeII GATC 4 cut(s) 131, 221, 493, 564
NlaIII CATG 3 cut(s) 144, 317, 513
PctI GAATGC 1 cut(s) 379
PfeI GAWTC 3 cut(s) 33, 326, 398
PkrI GCNGC 2 cut(s) 16, 196
Psp6I CCWGG 1 cut(s) 47
PspFI CCCAGC 2 cut(s) 37, 406
PspGI CCWGG 1 cut(s) 47
PstNI CAGNNNCTG 1 cut(s) 230
PsuI RGATCY 2 cut(s) 131, 493
RsaI GTAC 1 cut(s) 412
RsaNI GTAC 1 cut(s) 411
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 2 cut(s) 15, 195
Sau3AI GATC 4 cut(s) 131, 221, 493, 564
ScrFI CCNGG 1 cut(s) 49
SfaNI GCATC 3 cut(s) 175, 182, 296
SmlI CTYRAG 2 cut(s) 127, 335
SmoI CTYRAG 2 cut(s) 127, 335
Sse9I AATT 2 cut(s) 116, 254
SsiI CCGC 1 cut(s) 81
SspMI CTAG 1 cut(s) 20
StyD4I CCNGG 1 cut(s) 47
StyI CCWWGG 1 cut(s) 509
TaaI ACNGT 2 cut(s) 247, 359
TasI AATT 2 cut(s) 116, 254
TfiI GAWTC 3 cut(s) 33, 326, 398
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 2 cut(s) 364, 460
TseI GCWGC 2 cut(s) 14, 194
TspDTI ATGAA 2 cut(s) 129, 459
TspGWI ACGGA 2 cut(s) 288, 298
TspRI CASTG 2 cut(s) 364, 460
XapI RAATTY 1 cut(s) 116
XcmI CCANNNNNNNNNTGG 1 cut(s) 259
XmiI GTMKAC 1 cut(s) 166
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.