Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009152.1

Orthogroup ID

OG0009563

Physical Location & Seq

Genomic Coordinates Forward (+)

27694 .. 30064

Gene Structure 2371 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009152.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1158 bp

atggcctcccacgcagctctagcttcttcaagaatcccagccaacaccaggcttccctccaagacctcccactcttttcccgctcaatgcttctccaagaggctggaagttgctgaattctctggcttgagatccagttcatgtttgacctatgcaaccaatggtagacaggcatcattctttgatgctgtggctgctcaactcactcccaagacttcaggatcagctcctgttaagggagaaacggtggccaaattgaaggtggctatcaacggatttggacggattggcaggaactttctccgatgctggcatggccggaaggattcaccccttgaggtcattgttgtcaatgacagtggtggtgtcaagaatgcttcccacttgctgaaatatgattctatgctgggtactttcaaagcagatataaaaatagtggacaatgaaactatcagtgttgatggtaagcctgtcaaggttgtctctaacagagatcccttgaagcttccatgggctgagatgggcattgacattgttattgagggaacaggagtttttgttgatggccctggggctggtaaacacatccaagctggtgctaagaaagttatcattacagctccagcaaaaggtgccgatattcctacctatgttgtaggagtaaatgaaaaagattatggccatagcgttgcagacattgtgagcaacgcttcctgcaccacaaattgtctggctccttttgtgaaggtcctcgatgaagaattcggaattgtcaagggaaccatgacaactactcattcctacactggagaccaggtaaagaacgaagatgtcaatggagccttcagaaaggcagctgatgggccactgaagggcatattggcagtgtgtgatgttcctcttgtgtctgtagacttcaggtgcaccgatgtttcctccaccattgactcttccttgactatggtcatgggtgatgatatggtcaaggttgtggcctggtacgacaacgaatggggatacagccaaagggttgtggatttggcacatttggttgcaagcaagtggccagggacaccagtagtgggaagcggagacccgttggaggatttctgccaggataaccctgctgatgaagagtgcaaagtctatgaagcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00710 ko01100 ko01120 ko01200 map00710 map01100 map01120 map01200

Pfam Domains

Protein Families

CP12 Gp_dh_C Gp_dh_N

Protein Analysis

385

Amino Acids

41.06

Weight (kDa)

5.94

Isoelectric Point (pI)

25.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009563)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G42970
fragaria_vesca	FvH4_5g25760
malus_domestica	MD06G1006400.v1.1 MD06G1006500.v1.1
prunus_persica	Prupe.5G008000_v2.0.a1 Prupe.5G008000_v2.0.a1
pyrus_communis	pycom06g00570 pycom16g26090
rosa_chinensis	RchiOBHm_Chr7g0216231
rosa_laevigata	RLG00000002589
rosa_multiflora	Rmu_co8396877.1_g000001 Rmu_co8412739.1_g000001 Rmu_sc0003545.1_g000007 Rmu_sc0009152.1_g000005
rosa_roxburghii	Rroxscaffold_3G00243570
rosa_rugosa	Rorug07G0159100.1 Rorug07G0159200
rosa_samantha	Rh7AG296400 Rh7BG288600 Rh7CG316800 Rh7DG299100
rosa_wichuraiana	Rw7G025220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	632
AccBSI	CCGCTC	1 cut(s)	83
AccI	GTMKAC	2 cut(s)	166, 912
AciI	CCGC	2 cut(s)	81, 1089
AclWI	GGATC	3 cut(s)	126, 229, 488
AcoI	YGGCCR	4 cut(s)	249, 316, 679, 1064
AcsI	RAATTY	2 cut(s)	116, 761
AcuI	CTGAAG	4 cut(s)	201, 829, 890, 901
AfaI	GTAC	2 cut(s)	412, 1001
AfiI	CCNNNNNNNGG	7 cut(s)	48, 236, 575, 629, 872, 1082, 1102
AgsI	TTSAA	4 cut(s)	30, 259, 418, 502
AjnI	CCWGG	6 cut(s)	47, 568, 813, 995, 1066, 1113
AjuI	GAANNNNNNNTTGG	2 cut(s)	863, 895
AluBI	AGCT	8 cut(s)	17, 23, 227, 505, 593, 620, 857, 1154
AluI	AGCT	8 cut(s)	17, 23, 227, 505, 593, 620, 857, 1154
Alw21I	GWGCWC	1 cut(s)	926
Alw26I	GTCTC	3 cut(s)	487, 804, 1086
Alw44I	GTGCAC	1 cut(s)	922
AlwI	GGATC	3 cut(s)	126, 229, 488
AlwNI	CAGNNNCTG	1 cut(s)	230
AoxI	GGCC	8 cut(s)	3, 249, 316, 565, 679, 863, 993, 1064
ApaLI	GTGCAC	1 cut(s)	922
ApeKI	GCWGC	3 cut(s)	14, 194, 854
ApoI	RAATTY	2 cut(s)	116, 761
AspS9I	GGNCC	3 cut(s)	566, 748, 863
AsuHPI	GGTGA	2 cut(s)	321, 983
AvaII	GGWCC	1 cut(s)	748
BaeGI	GKGCMC	1 cut(s)	926
BalI	TGGCCA	3 cut(s)	251, 681, 1066
BanI	GGYRCC	1 cut(s)	632
Bbv12I	GWGCWC	1 cut(s)	926
BbvI	GCAGC	3 cut(s)	26, 181, 866
BccI	CCATC	4 cut(s)	455, 514, 557, 854
BciT130I	CCWGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
BciVI	GTATCC	1 cut(s)	1010
BcoDI	GTCTC	3 cut(s)	487, 804, 1086
BfaI	CTAG	1 cut(s)	20
BfmI	CTRYAG	1 cut(s)	909
BfuI	GTATCC	1 cut(s)	1010
BisI	GCNGC	3 cut(s)	15, 195, 855
BlsI	GCNGC	3 cut(s)	16, 196, 856
Bme1390I	CCNGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
Bme18I	GGWCC	1 cut(s)	748
BmgT120I	GGNCC	3 cut(s)	566, 748, 863
BmiI	GGNNCC	4 cut(s)	634, 735, 781, 841
BmrFI	CCNGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
BmsI	GCATC	3 cut(s)	175, 182, 296
BoxI	GACNNNNGTC	1 cut(s)	962
BpmI	CTGGAG	2 cut(s)	606, 828
BpuEI	CTTGAG	2 cut(s)	148, 356
BsaI	GGTCTC	2 cut(s)	804, 1086
BsaJI	CCNNGG	4 cut(s)	509, 568, 569, 1067
BsaXI	ACNNNNNCTCC	6 cut(s)	231, 261, 543, 573, 801, 831
Bsc4I	CCNNNNNNNGG	7 cut(s)	48, 236, 575, 629, 872, 1082, 1102
Bse1I	ACTGG	3 cut(s)	135, 811, 1076
BseBI	CCWGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
BseDI	CCNNGG	4 cut(s)	509, 568, 569, 1067
BseGI	GGATG	1 cut(s)	585
BseLI	CCNNNNNNNGG	7 cut(s)	48, 236, 575, 629, 872, 1082, 1102
BseMII	CTCAG	1 cut(s)	507
BseNI	ACTGG	3 cut(s)	135, 811, 1076
BseSI	GKGCMC	1 cut(s)	926
BseXI	GCAGC	3 cut(s)	26, 181, 866
BseYI	CCCAGC	2 cut(s)	37, 406
BsgI	GTGCAG	1 cut(s)	700
BshFI	GGCC	8 cut(s)	5, 251, 318, 567, 681, 865, 995, 1066
BshNI	GGYRCC	1 cut(s)	632
BsiHKAI	GWGCWC	1 cut(s)	926
BsiSI	CCGG	1 cut(s)	319
BslFI	GGGAC	1 cut(s)	1084
BslI	CCNNNNNNNGG	7 cut(s)	48, 236, 575, 629, 872, 1082, 1102
BsmAI	GTCTC	3 cut(s)	487, 804, 1086
BsmFI	GGGAC	1 cut(s)	1084
BsmI	GAATGC	1 cut(s)	379
BsnI	GGCC	8 cut(s)	5, 251, 318, 567, 681, 865, 995, 1066
Bso31I	GGTCTC	2 cut(s)	804, 1086
Bsp1286I	GDGCHC	1 cut(s)	926
Bsp143I	GATC	3 cut(s)	131, 221, 493
Bsp19I	CCATGG	1 cut(s)	509
BspACI	CCGC	2 cut(s)	81, 1089
BspANI	GGCC	8 cut(s)	5, 251, 318, 567, 681, 865, 995, 1066
BspCNI	CTCAG	1 cut(s)	508
BspLI	GGNNCC	4 cut(s)	634, 735, 781, 841
BspPI	GGATC	3 cut(s)	126, 229, 488
BspT107I	GGYRCC	1 cut(s)	632
BspTNI	GGTCTC	2 cut(s)	804, 1086
BsrBI	CCGCTC	1 cut(s)	83
BsrI	ACTGG	3 cut(s)	135, 811, 1076
BssECI	CCNNGG	4 cut(s)	509, 568, 569, 1067
BssMI	GATC	3 cut(s)	131, 221, 493
BssT1I	CCWWGG	1 cut(s)	509
Bst2UI	CCWGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
Bst4CI	ACNGT	2 cut(s)	247, 359
Bst6I	CTCTTC	2 cut(s)	955, 1128
BstAPI	GCANNNNNTGC	1 cut(s)	632
BstC8I	GCNNGC	2 cut(s)	311, 1057
BstDEI	CTNAG	3 cut(s)	516, 600, 1155
BstDSI	CCRYGG	1 cut(s)	509
BstF5I	GGATG	1 cut(s)	585
BstKTI	GATC	3 cut(s)	134, 224, 496
BstMAI	GTCTC	3 cut(s)	487, 804, 1086
BstMBI	GATC	3 cut(s)	131, 221, 493
BstMWI	GCNNNNNNNGC	5 cut(s)	11, 20, 194, 315, 632
BstNI	CCWGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
BstPAI	GACNNNNGTC	1 cut(s)	962
BstSCI	CCNGG	6 cut(s)	47, 568, 813, 995, 1066, 1113
BstSFI	CTRYAG	1 cut(s)	909
BstSLI	GKGCMC	1 cut(s)	926
BstV1I	GCAGC	3 cut(s)	26, 181, 866
BstX2I	RGATCY	2 cut(s)	131, 493
BstXI	CCANNNNNNTGG	1 cut(s)	103
BstYI	RGATCY	2 cut(s)	131, 493
BsuI	GTATCC	1 cut(s)	1010
BsuRI	GGCC	8 cut(s)	5, 251, 318, 567, 681, 865, 995, 1066
BtgI	CCRYGG	1 cut(s)	509
BtsCI	GGATG	1 cut(s)	585
BtsI	GCAGTG	1 cut(s)	891
BtsIMutI	CAGTG	5 cut(s)	364, 460, 804, 866, 891
Cac8I	GCNNGC	2 cut(s)	311, 1057
CaiI	CAGNNNCTG	1 cut(s)	230
Cfr13I	GGNCC	3 cut(s)	566, 748, 863
CsiI	ACCWGGT	1 cut(s)	813
Csp6I	GTAC	2 cut(s)	411, 1000
CspCI	CAANNNNNGTGG	2 cut(s)	340, 375
CviAII	CATG	5 cut(s)	141, 314, 510, 784, 967
CviQI	GTAC	2 cut(s)	411, 1000
DdeI	CTNAG	3 cut(s)	516, 600, 1155
DpnI	GATC	3 cut(s)	133, 223, 495
DpnII	GATC	3 cut(s)	131, 221, 493
EaeI	YGGCCR	4 cut(s)	249, 316, 679, 1064
Eam1104I	CTCTTC	2 cut(s)	955, 1128
EarI	CTCTTC	2 cut(s)	955, 1128
Eco130I	CCWWGG	1 cut(s)	509
Eco31I	GGTCTC	2 cut(s)	804, 1086
Eco47I	GGWCC	1 cut(s)	748
Eco57I	CTGAAG	4 cut(s)	201, 829, 890, 901
EcoO109I	RGGNCCY	1 cut(s)	748
EcoRI	GAATTC	2 cut(s)	116, 761
EcoRII	CCWGG	6 cut(s)	47, 568, 813, 995, 1066, 1113
EcoT14I	CCWWGG	1 cut(s)	509
ErhI	CCWWGG	1 cut(s)	509
FaeI	CATG	5 cut(s)	144, 317, 513, 787, 970
FaqI	GGGAC	1 cut(s)	1084
FatI	CATG	5 cut(s)	140, 313, 509, 783, 966
FauI	CCCGC	1 cut(s)	88
FblI	GTMKAC	2 cut(s)	166, 912
Fnu4HI	GCNGC	3 cut(s)	15, 195, 855
FokI	GGATG	1 cut(s)	572
Fsp4HI	GCNGC	3 cut(s)	15, 195, 855
FspBI	CTAG	1 cut(s)	20
GluI	GCNGC	3 cut(s)	15, 195, 855
GsaI	CCCAGC	2 cut(s)	41, 410
GsuI	CTGGAG	2 cut(s)	606, 828
HaeIII	GGCC	8 cut(s)	5, 251, 318, 567, 681, 865, 995, 1066
HapII	CCGG	1 cut(s)	319
Hin1II	CATG	5 cut(s)	144, 317, 513, 787, 970
HindIII	AAGCTT	2 cut(s)	503, 1152
HinfI	GANTC	4 cut(s)	33, 326, 398, 947
HpaII	CCGG	1 cut(s)	319
HphI	GGTGA	2 cut(s)	321, 983
Hpy166II	GTNNAC	5 cut(s)	167, 439, 581, 913, 924
Hpy188I	TCNGA	3 cut(s)	305, 767, 848
Hpy188III	TCNNGA	3 cut(s)	30, 219, 370
Hpy8I	GTNNAC	5 cut(s)	167, 439, 581, 913, 924
HpyAV	CCTTC	5 cut(s)	253, 316, 739, 853, 865
HpyCH4III	ACNGT	2 cut(s)	247, 359
HpyCH4V	TGCA	6 cut(s)	155, 692, 717, 924, 1055, 1140
HpyF10VI	GCNNNNNNNGC	5 cut(s)	11, 20, 194, 315, 632
HpyF3I	CTNAG	3 cut(s)	516, 600, 1155
Hsp92II	CATG	5 cut(s)	144, 317, 513, 787, 970
Kzo9I	GATC	3 cut(s)	131, 221, 493
LmnI	GCTCC	4 cut(s)	232, 625, 739, 839
Lsp1109I	GCAGC	3 cut(s)	26, 181, 866
LweI	GCATC	3 cut(s)	175, 182, 296
MabI	ACCWGGT	1 cut(s)	813
MaeI	CTAG	1 cut(s)	20
MalI	GATC	3 cut(s)	133, 223, 495
MbiI	CCGCTC	1 cut(s)	83
MboI	GATC	3 cut(s)	131, 221, 493
MboII	GAAGA	5 cut(s)	18, 770, 839, 942, 1145
MflI	RGATCY	2 cut(s)	131, 493
MhlI	GDGCHC	1 cut(s)	926
MlsI	TGGCCA	3 cut(s)	251, 681, 1066
MluCI	AATT	5 cut(s)	116, 254, 724, 761, 768
MluNI	TGGCCA	3 cut(s)	251, 681, 1066
MlyI	GAGTC	1 cut(s)	941
MmeI	TCCRAC	1 cut(s)	1080
Mox20I	TGGCCA	3 cut(s)	251, 681, 1066
MscI	TGGCCA	3 cut(s)	251, 681, 1066
MseI	TTAA	1 cut(s)	234
Msp20I	TGGCCA	3 cut(s)	251, 681, 1066
MspA1I	CMGCKG	1 cut(s)	857
MspI	CCGG	1 cut(s)	319
MspR9I	CCNGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
Mva1269I	GAATGC	1 cut(s)	379
MvaI	CCWGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
MwoI	GCNNNNNNNGC	5 cut(s)	11, 20, 194, 315, 632
NcoI	CCATGG	1 cut(s)	509
NdeII	GATC	3 cut(s)	131, 221, 493
NlaIII	CATG	5 cut(s)	144, 317, 513, 787, 970
NlaIV	GGNNCC	4 cut(s)	634, 735, 781, 841
PasI	CCCWGGG	1 cut(s)	569
PctI	GAATGC	1 cut(s)	379
PfeI	GAWTC	3 cut(s)	33, 326, 398
PkrI	GCNGC	3 cut(s)	16, 196, 856
PleI	GAGTC	1 cut(s)	941
PpsI	GAGTC	1 cut(s)	941
PpuMI	RGGWCCY	1 cut(s)	748
PshAI	GACNNNNGTC	1 cut(s)	962
Psp5II	RGGWCCY	1 cut(s)	748
Psp6I	CCWGG	6 cut(s)	47, 568, 813, 995, 1066, 1113
PspFI	CCCAGC	2 cut(s)	37, 406
PspGI	CCWGG	6 cut(s)	47, 568, 813, 995, 1066, 1113
PspN4I	GGNNCC	4 cut(s)	634, 735, 781, 841
PspPI	GGNCC	3 cut(s)	566, 748, 863
PspPPI	RGGWCCY	1 cut(s)	748
PstNI	CAGNNNCTG	1 cut(s)	230
PsuI	RGATCY	2 cut(s)	131, 493
PvuII	CAGCTG	1 cut(s)	857
RsaI	GTAC	2 cut(s)	412, 1001
RsaNI	GTAC	2 cut(s)	411, 1000
SaqAI	TTAA	1 cut(s)	234
SatI	GCNGC	3 cut(s)	15, 195, 855
Sau3AI	GATC	3 cut(s)	131, 221, 493
Sau96I	GGNCC	3 cut(s)	566, 748, 863
SchI	GAGTC	1 cut(s)	941
ScrFI	CCNGG	6 cut(s)	49, 570, 815, 997, 1068, 1115
SduI	GDGCHC	1 cut(s)	926
SexAI	ACCWGGT	1 cut(s)	813
SfaNI	GCATC	3 cut(s)	175, 182, 296
SfcI	CTRYAG	1 cut(s)	909
SinI	GGWCC	1 cut(s)	748
SmlI	CTYRAG	2 cut(s)	127, 335
SmoI	CTYRAG	2 cut(s)	127, 335
Sse9I	AATT	5 cut(s)	116, 254, 724, 761, 768
SsiI	CCGC	2 cut(s)	81, 1089
SspMI	CTAG	1 cut(s)	20
StyD4I	CCNGG	6 cut(s)	47, 568, 813, 995, 1066, 1113
StyI	CCWWGG	1 cut(s)	509
TaaI	ACNGT	2 cut(s)	247, 359
TaqI	TCGA	1 cut(s)	753
TasI	AATT	5 cut(s)	116, 254, 724, 761, 768
TfiI	GAWTC	3 cut(s)	33, 326, 398
Tru1I	TTAA	1 cut(s)	234
Tru9I	TTAA	1 cut(s)	234
TscAI	CASTG	5 cut(s)	364, 460, 811, 873, 891
TseI	GCWGC	3 cut(s)	14, 194, 854
TspDTI	ATGAA	5 cut(s)	129, 459, 681, 771, 1146
TspGWI	ACGGA	2 cut(s)	288, 298
TspRI	CASTG	5 cut(s)	364, 460, 811, 873, 891
VneI	GTGCAC	1 cut(s)	922
VpaK11BI	GGWCC	1 cut(s)	748
XapI	RAATTY	2 cut(s)	116, 761
XcmI	CCANNNNNNNNNTGG	2 cut(s)	259, 727
XmiI	GTMKAC	2 cut(s)	166, 912
XspI	CTAG	1 cut(s)	20

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.