Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8412739.1

Orthogroup ID

OG0009563

Physical Location & Seq

Genomic Coordinates Reverse (-)

4 .. 1351

Gene Structure 1348 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8412739.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 786 bp

gctggtaaacacatccaagctggtgctaagaaagttatcattacagctccagcaaaaggtgccgatattcctacctatgttgtaggagtaaatgaaaaagattatggccatagcgttgcagacattgtgagcaacgcttcctgcaccacaaattgtctggctccttttgtgaaggtcctcgatgaagaattcggaattgtcaagggaaccatgacaactactcattcctacactggagaccagagactgttggatgcttcacacagggacttgaggagagcaagggcagcagcactgaacatagtgcccacaagcactggtgcagccaaggcagtgtctctagtgctgcctcagctcaaaggcaagctcaatggcattgccctccgtgtgccaacacctaacgtgtcagtagtcgaccttgttattaatgttgcaaagaagggcattacagcagaagatgtcaatggagccttcagaaaggcagctgatgggccactgaagggcatattggcagtgtgtgatgttcctcttgtgtctgtagacttcaggtgcaccgatgtttcctccaccattgactcttccttgactatggtcatgggtgatgatatggtcaaggttgtggcctggtacgacaacgaatggggatacagccaaagggttgtggatttggcacatttggttgcaagcaagtggccagggacaccagtagtgggaagcggagacccgttggaggatttctgccaggataaccctgctgatgaagagtgcaaagtctatgaagcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00710 ko01100 ko01120 ko01200 map00710 map01100 map01120 map01200

Pfam Domains

Protein Families

CP12 Gp_dh_C Gp_dh_N

Protein Analysis

261

Amino Acids

27.64

Weight (kDa)

5.55

Isoelectric Point (pI)

22.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009563)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G42970
fragaria_vesca	FvH4_5g25760
malus_domestica	MD06G1006400.v1.1 MD06G1006500.v1.1
prunus_persica	Prupe.5G008000_v2.0.a1 Prupe.5G008000_v2.0.a1
pyrus_communis	pycom06g00570 pycom16g26090
rosa_chinensis	RchiOBHm_Chr7g0216231
rosa_laevigata	RLG00000002589
rosa_multiflora	Rmu_co8396877.1_g000001 Rmu_co8412739.1_g000001 Rmu_sc0003545.1_g000007 Rmu_sc0009152.1_g000005
rosa_roxburghii	Rroxscaffold_3G00243570
rosa_rugosa	Rorug07G0159100.1 Rorug07G0159200
rosa_samantha	Rh7AG296400 Rh7BG288600 Rh7CG316800 Rh7DG299100
rosa_wichuraiana	Rw7G025220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	59
AccI	GTMKAC	2 cut(s)	414, 540
AciI	CCGC	1 cut(s)	717
AcoI	YGGCCR	2 cut(s)	106, 692
AcsI	RAATTY	1 cut(s)	188
AcuI	CTGAAG	3 cut(s)	457, 518, 529
AfaI	GTAC	1 cut(s)	629
AfiI	CCNNNNNNNGG	4 cut(s)	56, 500, 710, 730
AflIII	ACRYGT	1 cut(s)	402
AjnI	CCWGG	3 cut(s)	623, 694, 741
AjuI	GAANNNNNNNTTGG	2 cut(s)	491, 523
AluBI	AGCT	6 cut(s)	20, 47, 355, 367, 485, 782
AluI	AGCT	6 cut(s)	20, 47, 355, 367, 485, 782
Alw21I	GWGCWC	1 cut(s)	554
Alw26I	GTCTC	4 cut(s)	231, 238, 342, 714
Alw44I	GTGCAC	1 cut(s)	550
AlwNI	CAGNNNCTG	1 cut(s)	247
AoxI	GGCC	4 cut(s)	106, 491, 621, 692
ApaLI	GTGCAC	1 cut(s)	550
ApeKI	GCWGC	5 cut(s)	287, 290, 323, 346, 482
ApoI	RAATTY	1 cut(s)	188
AseI	ATTAAT	1 cut(s)	426
AspS9I	GGNCC	2 cut(s)	175, 491
AsuHPI	GGTGA	1 cut(s)	611
AvaII	GGWCC	1 cut(s)	175
BaeGI	GKGCMC	2 cut(s)	309, 554
BalI	TGGCCA	2 cut(s)	108, 694
BanI	GGYRCC	1 cut(s)	59
Bbv12I	GWGCWC	1 cut(s)	554
BbvCI	CCTCAGC	1 cut(s)	351
BbvI	GCAGC	5 cut(s)	299, 302, 333, 335, 494
BccI	CCATC	1 cut(s)	482
BciT130I	CCWGG	3 cut(s)	625, 696, 743
BciVI	GTATCC	1 cut(s)	638
BcoDI	GTCTC	4 cut(s)	231, 238, 342, 714
BfaI	CTAG	1 cut(s)	341
BfmI	CTRYAG	1 cut(s)	537
BfuI	GTATCC	1 cut(s)	638
BisI	GCNGC	5 cut(s)	288, 291, 324, 347, 483
BlsI	GCNGC	5 cut(s)	289, 292, 325, 348, 484
Bme1390I	CCNGG	3 cut(s)	625, 696, 743
Bme18I	GGWCC	1 cut(s)	175
BmgT120I	GGNCC	2 cut(s)	175, 491
BmiI	GGNNCC	4 cut(s)	61, 162, 208, 469
BmrFI	CCNGG	3 cut(s)	625, 696, 743
BmsI	GCATC	1 cut(s)	244
BoxI	GACNNNNGTC	1 cut(s)	590
BpmI	CTGGAG	2 cut(s)	33, 255
Bpu10I	CCTNAGC	1 cut(s)	351
BpuEI	CTTGAG	1 cut(s)	292
BsaI	GGTCTC	2 cut(s)	231, 714
BsaJI	CCNNGG	2 cut(s)	327, 695
Bsc4I	CCNNNNNNNGG	4 cut(s)	56, 500, 710, 730
Bse1I	ACTGG	3 cut(s)	238, 322, 704
Bse3DI	GCAATG	1 cut(s)	375
BseBI	CCWGG	3 cut(s)	625, 696, 743
BseDI	CCNNGG	2 cut(s)	327, 695
BseGI	GGATG	2 cut(s)	12, 259
BseLI	CCNNNNNNNGG	4 cut(s)	56, 500, 710, 730
BseMI	GCAATG	1 cut(s)	375
BseMII	CTCAG	1 cut(s)	365
BseNI	ACTGG	3 cut(s)	238, 322, 704
BseRI	GAGGAG	1 cut(s)	289
BseSI	GKGCMC	2 cut(s)	309, 554
BseXI	GCAGC	5 cut(s)	299, 302, 333, 335, 494
BsgI	GTGCAG	2 cut(s)	127, 342
BshFI	GGCC	4 cut(s)	108, 493, 623, 694
BshNI	GGYRCC	1 cut(s)	59
BsiHKAI	GWGCWC	1 cut(s)	554
BslFI	GGGAC	2 cut(s)	281, 712
BslI	CCNNNNNNNGG	4 cut(s)	56, 500, 710, 730
BsmAI	GTCTC	4 cut(s)	231, 238, 342, 714
BsmFI	GGGAC	2 cut(s)	281, 712
BsnI	GGCC	4 cut(s)	108, 493, 623, 694
Bso31I	GGTCTC	2 cut(s)	231, 714
Bsp1286I	GDGCHC	2 cut(s)	309, 554
BspACI	CCGC	1 cut(s)	717
BspANI	GGCC	4 cut(s)	108, 493, 623, 694
BspCNI	CTCAG	1 cut(s)	364
BspLI	GGNNCC	4 cut(s)	61, 162, 208, 469
BspT107I	GGYRCC	1 cut(s)	59
BspTNI	GGTCTC	2 cut(s)	231, 714
BsrDI	GCAATG	1 cut(s)	375
BsrI	ACTGG	3 cut(s)	238, 322, 704
BssECI	CCNNGG	2 cut(s)	327, 695
BssT1I	CCWWGG	1 cut(s)	327
Bst2UI	CCWGG	3 cut(s)	625, 696, 743
Bst4CI	ACNGT	1 cut(s)	249
Bst6I	CTCTTC	2 cut(s)	583, 756
BstAPI	GCANNNNNTGC	1 cut(s)	59
BstC8I	GCNNGC	2 cut(s)	365, 685
BstDEI	CTNAG	3 cut(s)	27, 351, 783
BstF5I	GGATG	2 cut(s)	12, 259
BstMAI	GTCTC	4 cut(s)	231, 238, 342, 714
BstMWI	GCNNNNNNNGC	4 cut(s)	59, 287, 329, 352
BstNI	CCWGG	3 cut(s)	625, 696, 743
BstPAI	GACNNNNGTC	1 cut(s)	590
BstSCI	CCNGG	3 cut(s)	623, 694, 741
BstSFI	CTRYAG	1 cut(s)	537
BstSLI	GKGCMC	2 cut(s)	309, 554
BstV1I	GCAGC	5 cut(s)	299, 302, 333, 335, 494
BsuI	GTATCC	1 cut(s)	638
BsuRI	GGCC	4 cut(s)	108, 493, 623, 694
BtsCI	GGATG	2 cut(s)	12, 259
BtsI	GCAGTG	2 cut(s)	339, 519
BtsIMutI	CAGTG	6 cut(s)	231, 293, 315, 339, 494, 519
Cac8I	GCNNGC	2 cut(s)	365, 685
CaiI	CAGNNNCTG	1 cut(s)	247
Cfr13I	GGNCC	2 cut(s)	175, 491
Csp6I	GTAC	1 cut(s)	628
CviAII	CATG	2 cut(s)	211, 595
CviQI	GTAC	1 cut(s)	628
DdeI	CTNAG	3 cut(s)	27, 351, 783
EaeI	YGGCCR	2 cut(s)	106, 692
Eam1104I	CTCTTC	2 cut(s)	583, 756
EarI	CTCTTC	2 cut(s)	583, 756
Eco130I	CCWWGG	1 cut(s)	327
Eco31I	GGTCTC	2 cut(s)	231, 714
Eco47I	GGWCC	1 cut(s)	175
Eco57I	CTGAAG	3 cut(s)	457, 518, 529
EcoO109I	RGGNCCY	1 cut(s)	175
EcoRI	GAATTC	1 cut(s)	188
EcoRII	CCWGG	3 cut(s)	623, 694, 741
EcoT14I	CCWWGG	1 cut(s)	327
ErhI	CCWWGG	1 cut(s)	327
FaeI	CATG	2 cut(s)	214, 598
FaqI	GGGAC	2 cut(s)	281, 712
FatI	CATG	2 cut(s)	210, 594
FblI	GTMKAC	2 cut(s)	414, 540
Fnu4HI	GCNGC	5 cut(s)	288, 291, 324, 347, 483
FokI	GGATG	1 cut(s)	266
Fsp4HI	GCNGC	5 cut(s)	288, 291, 324, 347, 483
FspBI	CTAG	1 cut(s)	341
GluI	GCNGC	5 cut(s)	288, 291, 324, 347, 483
GsuI	CTGGAG	2 cut(s)	33, 255
HaeIII	GGCC	4 cut(s)	108, 493, 623, 694
Hin1II	CATG	2 cut(s)	214, 598
HincII	GTYRAC	1 cut(s)	415
HindII	GTYRAC	1 cut(s)	415
HindIII	AAGCTT	1 cut(s)	780
HinfI	GANTC	1 cut(s)	575
HphI	GGTGA	1 cut(s)	611
Hpy166II	GTNNAC	4 cut(s)	8, 415, 541, 552
Hpy188I	TCNGA	2 cut(s)	194, 476
Hpy8I	GTNNAC	4 cut(s)	8, 415, 541, 552
HpyAV	CCTTC	4 cut(s)	166, 433, 481, 493
HpyCH4III	ACNGT	1 cut(s)	249
HpyCH4IV	ACGT	1 cut(s)	402
HpyCH4V	TGCA	7 cut(s)	119, 144, 323, 434, 552, 683, 768
HpyF10VI	GCNNNNNNNGC	4 cut(s)	59, 287, 329, 352
HpyF3I	CTNAG	3 cut(s)	27, 351, 783
HpySE526I	ACGT	1 cut(s)	402
Hsp92II	CATG	2 cut(s)	214, 598
LmnI	GCTCC	3 cut(s)	52, 166, 467
Lsp1109I	GCAGC	5 cut(s)	299, 302, 333, 335, 494
LweI	GCATC	1 cut(s)	244
MaeI	CTAG	1 cut(s)	341
MaeII	ACGT	1 cut(s)	402
MboII	GAAGA	4 cut(s)	197, 467, 570, 773
MhlI	GDGCHC	2 cut(s)	309, 554
MlsI	TGGCCA	2 cut(s)	108, 694
MluCI	AATT	3 cut(s)	151, 188, 195
MluNI	TGGCCA	2 cut(s)	108, 694
MlyI	GAGTC	1 cut(s)	569
MmeI	TCCRAC	2 cut(s)	231, 708
MnlI	CCTC	7 cut(s)	188, 267, 360, 392, 537, 574, 724
Mox20I	TGGCCA	2 cut(s)	108, 694
MscI	TGGCCA	2 cut(s)	108, 694
MseI	TTAA	1 cut(s)	426
Msp20I	TGGCCA	2 cut(s)	108, 694
MspA1I	CMGCKG	1 cut(s)	485
MspR9I	CCNGG	3 cut(s)	625, 696, 743
MvaI	CCWGG	3 cut(s)	625, 696, 743
MwoI	GCNNNNNNNGC	4 cut(s)	59, 287, 329, 352
NlaIII	CATG	2 cut(s)	214, 598
NlaIV	GGNNCC	4 cut(s)	61, 162, 208, 469
PkrI	GCNGC	5 cut(s)	289, 292, 325, 348, 484
PleI	GAGTC	1 cut(s)	569
PpsI	GAGTC	1 cut(s)	569
PpuMI	RGGWCCY	1 cut(s)	175
PshAI	GACNNNNGTC	1 cut(s)	590
PshBI	ATTAAT	1 cut(s)	426
Psp5II	RGGWCCY	1 cut(s)	175
Psp6I	CCWGG	3 cut(s)	623, 694, 741
PspGI	CCWGG	3 cut(s)	623, 694, 741
PspN4I	GGNNCC	4 cut(s)	61, 162, 208, 469
PspPI	GGNCC	2 cut(s)	175, 491
PspPPI	RGGWCCY	1 cut(s)	175
PstNI	CAGNNNCTG	1 cut(s)	247
PvuII	CAGCTG	1 cut(s)	485
RsaI	GTAC	1 cut(s)	629
RsaNI	GTAC	1 cut(s)	628
SalI	GTCGAC	1 cut(s)	413
SaqAI	TTAA	1 cut(s)	426
SatI	GCNGC	5 cut(s)	288, 291, 324, 347, 483
Sau96I	GGNCC	2 cut(s)	175, 491
SchI	GAGTC	1 cut(s)	569
ScrFI	CCNGG	3 cut(s)	625, 696, 743
SduI	GDGCHC	2 cut(s)	309, 554
SfaNI	GCATC	1 cut(s)	244
SfcI	CTRYAG	1 cut(s)	537
SinI	GGWCC	1 cut(s)	175
SmlI	CTYRAG	1 cut(s)	271
SmoI	CTYRAG	1 cut(s)	271
Sse9I	AATT	3 cut(s)	151, 188, 195
SsiI	CCGC	1 cut(s)	717
SspMI	CTAG	1 cut(s)	341
StyD4I	CCNGG	3 cut(s)	623, 694, 741
StyI	CCWWGG	1 cut(s)	327
TaaI	ACNGT	1 cut(s)	249
TaiI	ACGT	1 cut(s)	405
TaqI	TCGA	2 cut(s)	180, 414
TasI	AATT	3 cut(s)	151, 188, 195
Tru1I	TTAA	1 cut(s)	426
Tru9I	TTAA	1 cut(s)	426
TscAI	CASTG	6 cut(s)	238, 300, 322, 339, 501, 519
TseI	GCWGC	5 cut(s)	287, 290, 323, 346, 482
TspDTI	ATGAA	3 cut(s)	108, 198, 774
TspGWI	ACGGA	1 cut(s)	374
TspRI	CASTG	6 cut(s)	238, 300, 322, 339, 501, 519
VneI	GTGCAC	1 cut(s)	550
VpaK11BI	GGWCC	1 cut(s)	175
VspI	ATTAAT	1 cut(s)	426
XapI	RAATTY	1 cut(s)	188
XcmI	CCANNNNNNNNNTGG	1 cut(s)	154
XmiI	GTMKAC	2 cut(s)	414, 540
XspI	CTAG	1 cut(s)	341

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.