Rmu_co8398367.1_g000001

PHD finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8398367.1
Physical Location & Seq
Forward (+)
776 .. 1259
484 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8398367.1_g000001.1.cds

Sequence Viewer

Length: 314 bp
atggcaatcgccaggacgggagtgtacgtagacgactatcttgaatacgcaagtacgttgcctgctgagctgcagaggcttctgaacactattcgagaactggacgaacgctctcaatcgatgatacaccagacgaggcagcagaccaagcactgcttgggattgtcaaagaaatggaacagcgaagaagatgaggcctccattgacaaaatgcgtagagaaattgaagccaatcaggagaatgcagtcagtctctgtactgagaaggttttgctcgcaaaacaagcttatgacctggtctcattctacccccc
Functional Annotation

Protein Analysis

105

Amino Acids

12.14

Weight (kDa)

5.15

Isoelectric Point (pI)

70.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 30
AfaI GTAC 3 cut(s) 26, 55, 259
AgsI TTSAA 2 cut(s) 44, 227
AjnI CCWGG 2 cut(s) 11, 294
AluBI AGCT 2 cut(s) 70, 287
AluI AGCT 2 cut(s) 70, 287
Alw26I GTCTC 2 cut(s) 257, 304
AlwNI CAGNNNCTG 1 cut(s) 255
AoxI GGCC 1 cut(s) 195
ApeKI GCWGC 2 cut(s) 70, 139
BbvI GCAGC 2 cut(s) 57, 151
BciT130I CCWGG 2 cut(s) 13, 296
BcoDI GTCTC 2 cut(s) 257, 304
BfmI CTRYAG 1 cut(s) 71
BisI GCNGC 2 cut(s) 71, 140
BlpI GCTNAGC 1 cut(s) 66
BlsI GCNGC 2 cut(s) 72, 141
Bme1390I CCNGG 2 cut(s) 13, 296
BmrFI CCNGG 2 cut(s) 13, 296
Bpu1102I GCTNAGC 1 cut(s) 66
Bsa29I ATCGAT 1 cut(s) 119
BsaAI YACGTR 1 cut(s) 28
BsaI GGTCTC 1 cut(s) 304
BsaXI ACNNNNNCTCC 2 cut(s) 12, 42
Bse1I ACTGG 1 cut(s) 105
BseBI CCWGG 2 cut(s) 13, 296
BseCI ATCGAT 1 cut(s) 119
BseMII CTCAG 2 cut(s) 57, 252
BseNI ACTGG 1 cut(s) 105
BseXI GCAGC 2 cut(s) 57, 151
BshFI GGCC 1 cut(s) 197
BshVI ATCGAT 1 cut(s) 119
BsmAI GTCTC 2 cut(s) 257, 304
BsmI GAATGC 1 cut(s) 247
BsnI GGCC 1 cut(s) 197
Bso31I GGTCTC 1 cut(s) 304
Bsp1720I GCTNAGC 1 cut(s) 66
BspANI GGCC 1 cut(s) 197
BspCNI CTCAG 2 cut(s) 58, 253
BspDI ATCGAT 1 cut(s) 119
BspMAI CTGCAG 1 cut(s) 75
BspTNI GGTCTC 1 cut(s) 304
BsrI ACTGG 1 cut(s) 105
Bst2UI CCWGG 2 cut(s) 13, 296
BstBAI YACGTR 1 cut(s) 28
BstC8I GCNNGC 2 cut(s) 63, 276
BstDEI CTNAG 2 cut(s) 66, 261
BstMAI GTCTC 2 cut(s) 257, 304
BstMWI GCNNNNNNNGC 4 cut(s) 67, 76, 148, 284
BstNI CCWGG 2 cut(s) 13, 296
BstSCI CCNGG 2 cut(s) 11, 294
BstSFI CTRYAG 1 cut(s) 71
BstSNI TACGTA 1 cut(s) 28
BstV1I GCAGC 2 cut(s) 57, 151
Bsu15I ATCGAT 1 cut(s) 119
BsuRI GGCC 1 cut(s) 197
BsuTUI ATCGAT 1 cut(s) 119
BtsI GCAGTG 1 cut(s) 151
BtsIMutI CAGTG 1 cut(s) 151
Cac8I GCNNGC 2 cut(s) 63, 276
CaiI CAGNNNCTG 1 cut(s) 255
ClaI ATCGAT 1 cut(s) 119
CsiI ACCWGGT 1 cut(s) 294
Csp6I GTAC 3 cut(s) 25, 54, 258
CviJI RGCY 5 cut(s) 70, 79, 197, 230, 287
CviKI_1 RGCY 5 cut(s) 70, 79, 197, 230, 287
CviQI GTAC 3 cut(s) 25, 54, 258
DdeI CTNAG 2 cut(s) 66, 261
Eco105I TACGTA 1 cut(s) 28
Eco147I AGGCCT 1 cut(s) 197
Eco31I GGTCTC 1 cut(s) 304
EcoRII CCWGG 2 cut(s) 11, 294
FaiI YATR 1 cut(s) 291
FalI AAGNNNNNCTT 2 cut(s) 140, 172
FblI GTMKAC 1 cut(s) 30
Fnu4HI GCNGC 2 cut(s) 71, 140
Fsp4HI GCNGC 2 cut(s) 71, 140
GluI GCNGC 2 cut(s) 71, 140
HaeIII GGCC 1 cut(s) 197
HindIII AAGCTT 1 cut(s) 285
Hpy166II GTNNAC 2 cut(s) 25, 31
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 3 cut(s) 41, 95, 236
Hpy8I GTNNAC 2 cut(s) 25, 31
HpyAV CCTTC 1 cut(s) 259
HpyCH4IV ACGT 2 cut(s) 27, 56
HpyCH4V TGCA 2 cut(s) 73, 245
HpyF10VI GCNNNNNNNGC 4 cut(s) 67, 76, 148, 284
HpyF3I CTNAG 2 cut(s) 66, 261
HpySE526I ACGT 2 cut(s) 27, 56
LpnPI CCDG 7 cut(s) 25, 75, 86, 143, 221, 281, 308
Lsp1109I GCAGC 2 cut(s) 57, 151
MabI ACCWGGT 1 cut(s) 294
MaeII ACGT 2 cut(s) 27, 56
MboII GAAGA 2 cut(s) 197, 200
MluCI AATT 1 cut(s) 222
MnlI CCTC 4 cut(s) 69, 129, 187, 208
MspR9I CCNGG 2 cut(s) 13, 296
Mva1269I GAATGC 1 cut(s) 247
MvaI CCWGG 2 cut(s) 13, 296
MwoI GCNNNNNNNGC 4 cut(s) 67, 76, 148, 284
PceI AGGCCT 1 cut(s) 197
PctI GAATGC 1 cut(s) 247
PflFI GACNNNGTC 1 cut(s) 296
PkrI GCNGC 2 cut(s) 72, 141
Ppu21I YACGTR 1 cut(s) 28
Psp6I CCWGG 2 cut(s) 11, 294
PspGI CCWGG 2 cut(s) 11, 294
PstI CTGCAG 1 cut(s) 75
PstNI CAGNNNCTG 1 cut(s) 255
PsyI GACNNNGTC 1 cut(s) 296
RsaI GTAC 3 cut(s) 26, 55, 259
RsaNI GTAC 3 cut(s) 25, 54, 258
SatI GCNGC 2 cut(s) 71, 140
ScrFI CCNGG 2 cut(s) 13, 296
SetI ASST 6 cut(s) 30, 59, 72, 270, 289, 297
SexAI ACCWGGT 1 cut(s) 294
SfcI CTRYAG 1 cut(s) 71
SnaBI TACGTA 1 cut(s) 28
Sse9I AATT 1 cut(s) 222
SseBI AGGCCT 1 cut(s) 197
StuI AGGCCT 1 cut(s) 197
StyD4I CCNGG 2 cut(s) 11, 294
TaiI ACGT 2 cut(s) 30, 59
TaqI TCGA 2 cut(s) 94, 119
TasI AATT 1 cut(s) 222
TatI WGTACW 1 cut(s) 257
TscAI CASTG 1 cut(s) 158
TseI GCWGC 2 cut(s) 70, 139
TspRI CASTG 1 cut(s) 158
Tth111I GACNNNGTC 1 cut(s) 296
XcmI CCANNNNNNNNNTGG 1 cut(s) 154
XmiI GTMKAC 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.