Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8431947.1

Orthogroup ID

OG0010249

Physical Location & Seq

Genomic Coordinates Reverse (-)

7 .. 893

Gene Structure 887 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8431947.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

atgttggttggatggggagctggatggcttggaattcggaaggaagatttaccaaagtatgaagaacaactagaactcaagaaagctaaggcacaactggaggaacttgagaaggaggctcttgaggcaatggaaactcaggcaaagcgggaggaattcaaagatgaggcaatggttgatgtaaagtctttggacatccgaaacttcatctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005507 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005739 GO:0005740 GO:0005743 GO:0005753 GO:0007275 GO:0008150 GO:0008270 GO:0009507 GO:0009536 GO:0009555 GO:0016020 GO:0016469 GO:0019866 GO:0031090 GO:0031966 GO:0031967 GO:0031974 GO:0031975 GO:0031981 GO:0032501 GO:0032502 GO:0032991 GO:0043167 GO:0043169 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044425 GO:0044428 GO:0044429 GO:0044444 GO:0044446 GO:0044455 GO:0044464 GO:0045259 GO:0046872 GO:0046914 GO:0048229 GO:0048856 GO:0050897 GO:0070013 GO:0098796 GO:0098798 GO:0098800

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mt_ATP_synt

Protein Analysis

70

Amino Acids

8.17

Weight (kDa)

4.76

Isoelectric Point (pI)

28.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010249)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21870 AT2G21870
fragaria_vesca	FvH4_1g22890
malus_domestica	MD01G1021000.v1.1 MD15G1331100.v1.1
prunus_persica	Prupe.6G169300_v2.0.a1
pyrus_communis	pycom01g05060 pycom15g29410
rosa_chinensis	RchiOBHm_Chr2g0117231
rosa_laevigata	RLG00000018337
rosa_multiflora	Rmu_co8431947.1_g000001
rosa_roxburghii	Rroxscaffold_2G00126620
rosa_rugosa	Rorug02G0211500
rosa_samantha	Rh2AG267100 Rh2AG268800 Rh2BG279400 Rh2DG274000 Rh2DG275900 Rh2DG293400
rosa_wichuraiana	Rw2G021080 Rw2G021130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	148
AcsI	RAATTY	2 cut(s)	33, 155
AgsI	TTSAA	1 cut(s)	160
AluBI	AGCT	2 cut(s)	20, 86
AluI	AGCT	2 cut(s)	20, 86
ApoI	RAATTY	2 cut(s)	33, 155
BccI	CCATC	2 cut(s)	6, 18
BfaI	CTAG	1 cut(s)	71
BpmI	CTGGAG	1 cut(s)	119
Bpu10I	CCTNAGC	1 cut(s)	87
BpuEI	CTTGAG	3 cut(s)	62, 128, 143
Bse1I	ACTGG	1 cut(s)	102
Bse3DI	GCAATG	2 cut(s)	135, 177
BseGI	GGATG	3 cut(s)	17, 29, 195
BseMI	GCAATG	2 cut(s)	135, 177
BseMII	CTCAG	1 cut(s)	152
BseNI	ACTGG	1 cut(s)	102
BspACI	CCGC	1 cut(s)	148
BspCNI	CTCAG	1 cut(s)	151
BsrDI	GCAATG	2 cut(s)	135, 177
BsrI	ACTGG	1 cut(s)	102
BstDEI	CTNAG	2 cut(s)	87, 138
BstF5I	GGATG	3 cut(s)	17, 29, 195
BstMWI	GCNNNNNNNGC	1 cut(s)	125
BtsCI	GGATG	3 cut(s)	17, 29, 195
CviJI	RGCY	4 cut(s)	20, 28, 86, 119
CviKI_1	RGCY	4 cut(s)	20, 28, 86, 119
DdeI	CTNAG	2 cut(s)	87, 138
EcoRI	GAATTC	2 cut(s)	33, 155
FaiI	YATR	1 cut(s)	60
FauI	CCCGC	1 cut(s)	141
FokI	GGATG	3 cut(s)	24, 36, 182
FspBI	CTAG	1 cut(s)	71
GsuI	CTGGAG	1 cut(s)	119
Hpy188I	TCNGA	2 cut(s)	39, 200
Hpy188III	TCNNGA	2 cut(s)	79, 122
HpyAV	CCTTC	2 cut(s)	34, 106
HpyF10VI	GCNNNNNNNGC	1 cut(s)	125
HpyF3I	CTNAG	2 cut(s)	87, 138
LmnI	GCTCC	1 cut(s)	17
LpnPI	CCDG	3 cut(s)	6, 83, 125
MaeI	CTAG	1 cut(s)	71
MboII	GAAGA	2 cut(s)	56, 74
MluCI	AATT	2 cut(s)	33, 155
MnlI	CCTC	5 cut(s)	94, 109, 118, 145, 160
MwoI	GCNNNNNNNGC	1 cut(s)	125
SetI	ASST	2 cut(s)	22, 88
SgeI	CNNG	9 cut(s)	33, 41, 83, 91, 110, 119, 134, 152, 161
SmlI	CTYRAG	3 cut(s)	77, 107, 122
SmoI	CTYRAG	3 cut(s)	77, 107, 122
Sse9I	AATT	2 cut(s)	33, 155
SsiI	CCGC	1 cut(s)	148
SspMI	CTAG	1 cut(s)	71
TasI	AATT	2 cut(s)	33, 155
TspDTI	ATGAA	2 cut(s)	75, 196
XapI	RAATTY	2 cut(s)	33, 155
XspI	CTAG	1 cut(s)	71

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.