Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8440155.1

Orthogroup ID

OG0014774

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 816

Gene Structure 815 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8440155.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 677 bp

atggcaaatacatctgacagcattgtgttggataatggccttgtccaactaacgttctctaatcccgatggcgacgttattggaatcagatatgggggaattgataacttgcttgaaatccacaataagccaactaatagaggttactgcgatttgaactggaacaatctgggagagaagagtagtatctttgaacgagtattgggaacagaatttcgagtgatcacagctacggaagaccaaatagaaatctctttcaccagaacatacaatgtttcccttccccaggaggggtggcccaaagtggtgatttatcaaataagaatggttttcaagcttcaacaagccaagttctggtacatggcactatcggacactagacaaaggttcatgccaacagcctatgaacgtggatattatggtatgaaactcgcctacaaagaatttgttctcctaaacaatacaagagaggtagatgacaagtatcagtactcaattgaggacaaggataacaagatgatcacaccaagtgatgagttccgcatggccggtccattcaagcagggtctcacttcccacgttgatcccaccaccctctcagtgtttgttagtacccattccgctgggaatgctgggatgaccttccaagaaggtgaggcatggaaaaggttttctgt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CBM-like Rhamnogal_lyase fn3_3

Protein Analysis

226

Amino Acids

25.94

Weight (kDa)

5.47

Isoelectric Point (pI)

31.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014774)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g37410
malus_domestica	MD02G1298700.v1.1 MD02G1298900.v1.1
rosa_chinensis	RchiOBHm_Chr2g0088441 RchiOBHm_Chr2g0150211 RchiOBHm_Chr2g0150221
rosa_laevigata	RLG00000015955 RLG00000020479
rosa_multiflora	Rmu_co8045638.1_g000001 Rmu_co8440155.1_g000001 Rmu_sc0004733.1_g000016 Rmu_sc0037686.1_g000001 Rmu_ssc0000020.1_g000007
rosa_roxburghii	Rroxscaffold_2G00097360
rosa_samantha	Rh2BG491200 Rh2CG039200 Rh2DG500000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	354
AciI	CCGC	2 cut(s)	541, 621
AclI	AACGTT	1 cut(s)	53
AclWI	GGATC	1 cut(s)	578
AcoI	YGGCCR	1 cut(s)	546
AcsI	RAATTY	2 cut(s)	212, 443
AdeI	CACNNNGTG	1 cut(s)	530
AfaI	GTAC	3 cut(s)	359, 491, 613
AfiI	CCNNNNNNNGG	4 cut(s)	286, 290, 291, 354
AgsI	TTSAA	6 cut(s)	116, 157, 194, 334, 341, 559
AjnI	CCWGG	1 cut(s)	285
AluBI	AGCT	2 cut(s)	230, 337
AluI	AGCT	2 cut(s)	230, 337
Alw26I	GTCTC	1 cut(s)	572
AlwI	GGATC	1 cut(s)	578
AoxI	GGCC	3 cut(s)	37, 296, 546
ApoI	RAATTY	2 cut(s)	212, 443
Asp700I	GAANNNNTTC	1 cut(s)	447
AspS9I	GGNCC	2 cut(s)	297, 551
AsuHPI	GGTGA	3 cut(s)	250, 319, 665
AvaII	GGWCC	1 cut(s)	551
BbsI	GAAGAC	1 cut(s)	243
BccI	CCATC	1 cut(s)	62
BciT130I	CCWGG	1 cut(s)	287
BclI	TGATCA	2 cut(s)	222, 519
BcoDI	GTCTC	1 cut(s)	572
BfaI	CTAG	1 cut(s)	378
BmcAI	AGTACT	1 cut(s)	491
Bme1390I	CCNGG	1 cut(s)	287
Bme18I	GGWCC	1 cut(s)	551
BmgT120I	GGNCC	2 cut(s)	297, 551
BmrFI	CCNGG	1 cut(s)	287
BpiI	GAAGAC	1 cut(s)	243
BsaI	GGTCTC	1 cut(s)	572
BsaJI	CCNNGG	1 cut(s)	285
Bsc4I	CCNNNNNNNGG	4 cut(s)	286, 290, 291, 354
Bse118I	RCCGGY	1 cut(s)	548
Bse1I	ACTGG	1 cut(s)	164
BseBI	CCWGG	1 cut(s)	287
BseDI	CCNNGG	1 cut(s)	285
BseGI	GGATG	1 cut(s)	642
BseLI	CCNNNNNNNGG	4 cut(s)	286, 290, 291, 354
BseMII	CTCAG	1 cut(s)	612
BseNI	ACTGG	1 cut(s)	164
BseYI	CCCAGC	2 cut(s)	623, 632
BshFI	GGCC	3 cut(s)	39, 298, 548
BsiSI	CCGG	1 cut(s)	549
BslI	CCNNNNNNNGG	4 cut(s)	286, 290, 291, 354
BsmAI	GTCTC	1 cut(s)	572
BsmI	GAATGC	1 cut(s)	634
BsnI	GGCC	3 cut(s)	39, 298, 548
Bso31I	GGTCTC	1 cut(s)	572
Bsp143I	GATC	3 cut(s)	222, 519, 583
BspACI	CCGC	2 cut(s)	541, 621
BspANI	GGCC	3 cut(s)	39, 298, 548
BspCNI	CTCAG	1 cut(s)	611
BspPI	GGATC	1 cut(s)	578
BspTNI	GGTCTC	1 cut(s)	572
BsrFI	RCCGGY	1 cut(s)	548
BsrI	ACTGG	1 cut(s)	164
BssAI	RCCGGY	1 cut(s)	548
BssECI	CCNNGG	1 cut(s)	285
BssMI	GATC	3 cut(s)	222, 519, 583
Bst2UI	CCWGG	1 cut(s)	287
Bst6I	CTCTTC	1 cut(s)	173
BstDEI	CTNAG	1 cut(s)	598
BstENI	CCTNNNNNAGG	1 cut(s)	284
BstF5I	GGATG	1 cut(s)	642
BstKTI	GATC	3 cut(s)	225, 522, 586
BstMAI	GTCTC	1 cut(s)	572
BstMBI	GATC	3 cut(s)	222, 519, 583
BstMWI	GCNNNNNNNGC	1 cut(s)	629
BstNI	CCWGG	1 cut(s)	287
BstSCI	CCNGG	1 cut(s)	285
BstV2I	GAAGAC	1 cut(s)	243
BstXI	CCANNNNNNTGG	1 cut(s)	623
BsuRI	GGCC	3 cut(s)	39, 298, 548
BtsCI	GGATG	1 cut(s)	642
BtsIMutI	CAGTG	1 cut(s)	606
Cfr10I	RCCGGY	1 cut(s)	548
Cfr13I	GGNCC	2 cut(s)	297, 551
Csp6I	GTAC	3 cut(s)	358, 490, 612
CviAII	CATG	4 cut(s)	361, 391, 544, 660
CviJI	RGCY	8 cut(s)	39, 130, 230, 298, 337, 347, 401, 548
CviKI_1	RGCY	8 cut(s)	39, 130, 230, 298, 337, 347, 401, 548
CviQI	GTAC	3 cut(s)	358, 490, 612
DdeI	CTNAG	1 cut(s)	598
DpnI	GATC	3 cut(s)	224, 521, 585
DpnII	GATC	3 cut(s)	222, 519, 583
DraIII	CACNNNGTG	1 cut(s)	530
EaeI	YGGCCR	1 cut(s)	546
Eam1104I	CTCTTC	1 cut(s)	173
EarI	CTCTTC	1 cut(s)	173
Eco31I	GGTCTC	1 cut(s)	572
Eco47I	GGWCC	1 cut(s)	551
EcoNI	CCTNNNNNAGG	1 cut(s)	284
EcoRII	CCWGG	1 cut(s)	285
FaeI	CATG	4 cut(s)	364, 394, 547, 663
FaiI	YATR	9 cut(s)	93, 268, 362, 392, 405, 420, 425, 545, 661
FatI	CATG	4 cut(s)	360, 390, 543, 659
FbaI	TGATCA	2 cut(s)	222, 519
FokI	GGATG	1 cut(s)	649
FspBI	CTAG	1 cut(s)	378
GsaI	CCCAGC	2 cut(s)	627, 636
HaeIII	GGCC	3 cut(s)	39, 298, 548
HapII	CCGG	1 cut(s)	549
Hin1II	CATG	4 cut(s)	364, 394, 547, 663
HindIII	AAGCTT	1 cut(s)	335
HinfI	GANTC	1 cut(s)	84
HpaII	CCGG	1 cut(s)	549
HphI	GGTGA	3 cut(s)	250, 319, 665
Hpy188I	TCNGA	3 cut(s)	16, 89, 373
Hpy188III	TCNNGA	1 cut(s)	65
Hpy99I	CGWCG	1 cut(s)	77
HpyAV	CCTTC	3 cut(s)	290, 644, 652
HpyCH4IV	ACGT	4 cut(s)	53, 75, 409, 579
HpyF10VI	GCNNNNNNNGC	1 cut(s)	629
HpyF3I	CTNAG	1 cut(s)	598
HpySE526I	ACGT	4 cut(s)	53, 75, 409, 579
Hsp92II	CATG	4 cut(s)	364, 394, 547, 663
Ksp22I	TGATCA	2 cut(s)	222, 519
Kzo9I	GATC	3 cut(s)	222, 519, 583
MaeI	CTAG	1 cut(s)	378
MaeII	ACGT	4 cut(s)	53, 75, 409, 579
MaeIII	GTNAC	1 cut(s)	143
MalI	GATC	3 cut(s)	224, 521, 585
MboI	GATC	3 cut(s)	222, 519, 583
MboII	GAAGA	2 cut(s)	190, 248
MfeI	CAATTG	1 cut(s)	495
MluCI	AATT	4 cut(s)	99, 212, 443, 495
MmeI	TCCRAC	2 cut(s)	9, 70
MnlI	CCTC	6 cut(s)	134, 283, 463, 493, 605, 649
MroXI	GAANNNNTTC	1 cut(s)	447
MspA1I	CMGCKG	1 cut(s)	623
MspI	CCGG	1 cut(s)	549
MspR9I	CCNGG	1 cut(s)	287
MunI	CAATTG	1 cut(s)	495
Mva1269I	GAATGC	1 cut(s)	634
MvaI	CCWGG	1 cut(s)	287
MwoI	GCNNNNNNNGC	1 cut(s)	629
NdeII	GATC	3 cut(s)	222, 519, 583
NlaIII	CATG	4 cut(s)	364, 394, 547, 663
PctI	GAATGC	1 cut(s)	634
PdmI	GAANNNNTTC	1 cut(s)	447
PfeI	GAWTC	1 cut(s)	84
PflMI	CCANNNNNTGG	1 cut(s)	354
Psp1406I	AACGTT	1 cut(s)	53
Psp6I	CCWGG	1 cut(s)	285
PspFI	CCCAGC	2 cut(s)	623, 632
PspGI	CCWGG	1 cut(s)	285
PspPI	GGNCC	2 cut(s)	297, 551
RsaI	GTAC	3 cut(s)	359, 491, 613
RsaNI	GTAC	3 cut(s)	358, 490, 612
Sau3AI	GATC	3 cut(s)	222, 519, 583
Sau96I	GGNCC	2 cut(s)	297, 551
ScaI	AGTACT	1 cut(s)	491
ScrFI	CCNGG	1 cut(s)	287
SinI	GGWCC	1 cut(s)	551
Sse9I	AATT	4 cut(s)	99, 212, 443, 495
SsiI	CCGC	2 cut(s)	541, 621
SspMI	CTAG	1 cut(s)	378
StyD4I	CCNGG	1 cut(s)	285
TaiI	ACGT	4 cut(s)	56, 78, 412, 582
TaqI	TCGA	1 cut(s)	217
TasI	AATT	4 cut(s)	99, 212, 443, 495
TatI	WGTACW	1 cut(s)	489
TfiI	GAWTC	1 cut(s)	84
TscAI	CASTG	1 cut(s)	606
TspDTI	ATGAA	3 cut(s)	379, 420, 440
TspGWI	ACGGA	1 cut(s)	248
TspRI	CASTG	1 cut(s)	606
Van91I	CCANNNNNTGG	1 cut(s)	354
VpaK11BI	GGWCC	1 cut(s)	551
XagI	CCTNNNNNAGG	1 cut(s)	284
XapI	RAATTY	2 cut(s)	212, 443
XmnI	GAANNNNTTC	1 cut(s)	447
XspI	CTAG	1 cut(s)	378
ZrmI	AGTACT	1 cut(s)	491

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.