Rmu_ssc0000020.1_g000007

Rhamnogalacturonate lyase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000020.1
OG0014774
Physical Location & Seq
Reverse (-)
22275 .. 22928
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000020.1_g000007.1.cds

Sequence Viewer

Length: 564 bp
atggcaaatacatctgacagcattgtgttggataatggccttgtccaactaacgttctctaatcccgatggcgacgttattggaatcagatatgggggaattgataacttgcttgaaatccacaataagccaactaatagaggttactgcgatttgaactggaacaatctgggagagaagagcagtatctttgaacgagtattgggaacagaatttcgagtgatcacagctacggaagaccaaatagaaatctctttcaccagaacatacaatgtttcccttccccaggaggggtggcccaaagtggtgatttatcaaataagaatggttttcaagcttcaacaagccaagttctggtacatggcactatcggacactagacaaaggttcatgccaacagcctatgaacgtggatattatggtatgaaactcgcctacaaagaatttgttctcctaaacaatacaagagaggtagatgacaagtatcagtactcaagtgaggacaaggataacaaggtgcatggttggatttgtaccgatgatgaatcacatgttgggttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CBM-like Rhamnogal_lyase fn3_3

Protein Analysis

187

Amino Acids

21.72

Weight (kDa)

5.1

Isoelectric Point (pI)

31.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 354
AclI AACGTT 1 cut(s) 53
AcsI RAATTY 2 cut(s) 212, 443
AfaI GTAC 3 cut(s) 359, 491, 535
AfiI CCNNNNNNNGG 4 cut(s) 286, 290, 291, 354
AflIII ACRYGT 1 cut(s) 550
AgsI TTSAA 5 cut(s) 116, 157, 194, 334, 341
AjnI CCWGG 1 cut(s) 285
AjuI GAANNNNNNNTTGG 1 cut(s) 537
AluBI AGCT 2 cut(s) 230, 337
AluI AGCT 2 cut(s) 230, 337
AoxI GGCC 2 cut(s) 37, 296
ApoI RAATTY 2 cut(s) 212, 443
Asp700I GAANNNNTTC 1 cut(s) 447
AspS9I GGNCC 1 cut(s) 297
AsuHPI GGTGA 2 cut(s) 250, 319
BbsI GAAGAC 1 cut(s) 243
BccI CCATC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 287
BclI TGATCA 1 cut(s) 222
BfaI CTAG 1 cut(s) 378
BmcAI AGTACT 1 cut(s) 491
Bme1390I CCNGG 1 cut(s) 287
BmgT120I GGNCC 1 cut(s) 297
BmrFI CCNGG 1 cut(s) 287
BpiI GAAGAC 1 cut(s) 243
BpuEI CTTGAG 1 cut(s) 478
BsaJI CCNNGG 1 cut(s) 285
Bsc4I CCNNNNNNNGG 4 cut(s) 286, 290, 291, 354
Bse1I ACTGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 287
BseDI CCNNGG 1 cut(s) 285
BseLI CCNNNNNNNGG 4 cut(s) 286, 290, 291, 354
BseNI ACTGG 1 cut(s) 164
BshFI GGCC 2 cut(s) 39, 298
BslI CCNNNNNNNGG 4 cut(s) 286, 290, 291, 354
BsnI GGCC 2 cut(s) 39, 298
Bsp143I GATC 1 cut(s) 222
BspANI GGCC 2 cut(s) 39, 298
BspQI GCTCTTC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 164
BssECI CCNNGG 1 cut(s) 285
BssMI GATC 1 cut(s) 222
Bst2UI CCWGG 1 cut(s) 287
Bst6I CTCTTC 1 cut(s) 173
BstENI CCTNNNNNAGG 1 cut(s) 284
BstKTI GATC 1 cut(s) 225
BstMBI GATC 1 cut(s) 222
BstNI CCWGG 1 cut(s) 287
BstNSI RCATGY 1 cut(s) 554
BstSCI CCNGG 1 cut(s) 285
BstV2I GAAGAC 1 cut(s) 243
BsuRI GGCC 2 cut(s) 39, 298
Cfr13I GGNCC 1 cut(s) 297
Csp6I GTAC 3 cut(s) 358, 490, 534
CviAII CATG 4 cut(s) 361, 391, 521, 551
CviJI RGCY 7 cut(s) 39, 130, 230, 298, 337, 347, 401
CviKI_1 RGCY 7 cut(s) 39, 130, 230, 298, 337, 347, 401
CviQI GTAC 3 cut(s) 358, 490, 534
DpnI GATC 1 cut(s) 224
DpnII GATC 1 cut(s) 222
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
EcoNI CCTNNNNNAGG 1 cut(s) 284
EcoRII CCWGG 1 cut(s) 285
FaeI CATG 4 cut(s) 364, 394, 524, 554
FaiI YATR 9 cut(s) 93, 268, 362, 392, 405, 420, 425, 522, 552
FatI CATG 4 cut(s) 360, 390, 520, 550
FbaI TGATCA 1 cut(s) 222
FspBI CTAG 1 cut(s) 378
HaeIII GGCC 2 cut(s) 39, 298
Hin1II CATG 4 cut(s) 364, 394, 524, 554
HindIII AAGCTT 1 cut(s) 335
HinfI GANTC 2 cut(s) 84, 545
HphI GGTGA 2 cut(s) 250, 319
Hpy188I TCNGA 3 cut(s) 16, 89, 373
Hpy188III TCNNGA 1 cut(s) 65
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 290
HpyCH4IV ACGT 3 cut(s) 53, 75, 409
HpyCH4V TGCA 1 cut(s) 520
HpySE526I ACGT 3 cut(s) 53, 75, 409
Hsp92II CATG 4 cut(s) 364, 394, 524, 554
Ksp22I TGATCA 1 cut(s) 222
Kzo9I GATC 1 cut(s) 222
LguI GCTCTTC 1 cut(s) 173
LpnPI CCDG 6 cut(s) 145, 155, 272, 274, 299, 340
MaeI CTAG 1 cut(s) 378
MaeII ACGT 3 cut(s) 53, 75, 409
MaeIII GTNAC 1 cut(s) 143
MalI GATC 1 cut(s) 224
MboI GATC 1 cut(s) 222
MboII GAAGA 2 cut(s) 190, 248
MluCI AATT 3 cut(s) 99, 212, 443
MmeI TCCRAC 3 cut(s) 9, 70, 506
MnlI CCTC 4 cut(s) 134, 283, 463, 493
MroXI GAANNNNTTC 1 cut(s) 447
MspR9I CCNGG 1 cut(s) 287
MvaI CCWGG 1 cut(s) 287
NdeII GATC 1 cut(s) 222
NlaIII CATG 4 cut(s) 364, 394, 524, 554
NspI RCATGY 1 cut(s) 554
PciI ACATGT 1 cut(s) 550
PciSI GCTCTTC 1 cut(s) 173
PdmI GAANNNNTTC 1 cut(s) 447
PfeI GAWTC 2 cut(s) 84, 545
PflMI CCANNNNNTGG 1 cut(s) 354
PscI ACATGT 1 cut(s) 550
Psp1406I AACGTT 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 285
PspGI CCWGG 1 cut(s) 285
PspPI GGNCC 1 cut(s) 297
RsaI GTAC 3 cut(s) 359, 491, 535
RsaNI GTAC 3 cut(s) 358, 490, 534
SapI GCTCTTC 1 cut(s) 173
Sau3AI GATC 1 cut(s) 222
Sau96I GGNCC 1 cut(s) 297
ScaI AGTACT 1 cut(s) 491
ScrFI CCNGG 1 cut(s) 287
SetI ASST 9 cut(s) 56, 78, 145, 232, 339, 389, 412, 474, 519
SmlI CTYRAG 1 cut(s) 493
SmoI CTYRAG 1 cut(s) 493
Sse9I AATT 3 cut(s) 99, 212, 443
SspMI CTAG 1 cut(s) 378
StyD4I CCNGG 1 cut(s) 285
TaiI ACGT 3 cut(s) 56, 78, 412
TaqI TCGA 1 cut(s) 217
TasI AATT 3 cut(s) 99, 212, 443
TatI WGTACW 1 cut(s) 489
TfiI GAWTC 2 cut(s) 84, 545
TspDTI ATGAA 4 cut(s) 379, 420, 440, 558
TspGWI ACGGA 1 cut(s) 248
Van91I CCANNNNNTGG 1 cut(s) 354
XagI CCTNNNNNAGG 1 cut(s) 284
XapI RAATTY 2 cut(s) 212, 443
XceI RCATGY 1 cut(s) 554
XmnI GAANNNNTTC 1 cut(s) 447
XspI CTAG 1 cut(s) 378
ZrmI AGTACT 1 cut(s) 491
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.