Rh2BG491200

Rhamnogalacturonate lyase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
69055350 .. 69055673
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG491200.1

Sequence Viewer

Length: 324 bp
ATGGCAAATACATCTGACAGCATTGTGTTGGATAATGGCCTTGTCCAACTAACGTTCTCTAATCCCGATGGCGACGTTATTGGAATCAGATATGGGGGAATTGATAACTTGCTTGAAATCCACAATAAGCCAACTAATAGAGGTTACTGCGATTTGAACTGGAACAATCTGGGAGAGAAGAGCAGTATCTTTGAACGAGTATTGGGAACAGAATTTCGAGTGATCACAGCTACGGAAGACCAAATAGAAATCTCTTTCACCAGAACATACAATGTTTCCCTTCCCCAGGGTGTGACAGTTCCATTTAATGTGGACAAAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.95

Weight (kDa)

4.64

Isoelectric Point (pI)

32.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rhamnogal_lyase PF06045 6 - 107 3e-37 Rhamnogalacturonate lyase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 53
AcsI RAATTY 1 cut(s) 212
AfiI CCNNNNNNNGG 1 cut(s) 286
AgsI TTSAA 3 cut(s) 116, 157, 194
AjnI CCWGG 1 cut(s) 285
AluBI AGCT 1 cut(s) 230
AluI AGCT 1 cut(s) 230
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 212
AsuHPI GGTGA 1 cut(s) 250
BbsI GAAGAC 1 cut(s) 243
BccI CCATC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 287
BclI TGATCA 1 cut(s) 222
Bme1390I CCNGG 1 cut(s) 287
BmrFI CCNGG 1 cut(s) 287
BpiI GAAGAC 1 cut(s) 243
BsaJI CCNNGG 2 cut(s) 285, 286
Bsc4I CCNNNNNNNGG 1 cut(s) 286
Bse1I ACTGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 287
BseDI CCNNGG 2 cut(s) 285, 286
BseLI CCNNNNNNNGG 1 cut(s) 286
BseNI ACTGG 1 cut(s) 164
BshFI GGCC 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 286
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 222
BspANI GGCC 1 cut(s) 39
BspQI GCTCTTC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 164
BssECI CCNNGG 2 cut(s) 285, 286
BssMI GATC 1 cut(s) 222
Bst2UI CCWGG 1 cut(s) 287
Bst4CI ACNGT 1 cut(s) 298
Bst6I CTCTTC 1 cut(s) 173
BstENI CCTNNNNNAGG 1 cut(s) 284
BstKTI GATC 1 cut(s) 225
BstMBI GATC 1 cut(s) 222
BstNI CCWGG 1 cut(s) 287
BstSCI CCNGG 1 cut(s) 285
BstV2I GAAGAC 1 cut(s) 243
BsuRI GGCC 1 cut(s) 39
CviJI RGCY 3 cut(s) 39, 130, 230
CviKI_1 RGCY 3 cut(s) 39, 130, 230
DpnI GATC 1 cut(s) 224
DpnII GATC 1 cut(s) 222
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
EcoNI CCTNNNNNAGG 1 cut(s) 284
EcoRII CCWGG 1 cut(s) 285
FaiI YATR 2 cut(s) 93, 268
FbaI TGATCA 1 cut(s) 222
HaeIII GGCC 1 cut(s) 39
HinfI GANTC 1 cut(s) 84
HphI GGTGA 1 cut(s) 250
Hpy166II GTNNAC 1 cut(s) 313
Hpy188I TCNGA 2 cut(s) 16, 89
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 313
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 290
HpyCH4III ACNGT 1 cut(s) 298
HpyCH4IV ACGT 2 cut(s) 53, 75
HpySE526I ACGT 2 cut(s) 53, 75
Ksp22I TGATCA 1 cut(s) 222
Kzo9I GATC 1 cut(s) 222
LguI GCTCTTC 1 cut(s) 173
LpnPI CCDG 5 cut(s) 145, 155, 272, 274, 299
MaeII ACGT 2 cut(s) 53, 75
MaeIII GTNAC 2 cut(s) 143, 292
MalI GATC 1 cut(s) 224
MboI GATC 1 cut(s) 222
MboII GAAGA 2 cut(s) 190, 248
MluCI AATT 2 cut(s) 99, 212
MmeI TCCRAC 2 cut(s) 9, 70
MnlI CCTC 1 cut(s) 134
MseI TTAA 1 cut(s) 306
MspR9I CCNGG 1 cut(s) 287
MvaI CCWGG 1 cut(s) 287
NdeII GATC 1 cut(s) 222
NmuCI GTSAC 1 cut(s) 292
PasI CCCWGGG 1 cut(s) 286
PciSI GCTCTTC 1 cut(s) 173
PfeI GAWTC 1 cut(s) 84
Psp1406I AACGTT 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 285
PspGI CCWGG 1 cut(s) 285
SapI GCTCTTC 1 cut(s) 173
SaqAI TTAA 1 cut(s) 306
Sau3AI GATC 1 cut(s) 222
ScrFI CCNGG 1 cut(s) 287
SetI ASST 5 cut(s) 56, 78, 145, 232, 323
Sse9I AATT 2 cut(s) 99, 212
StyD4I CCNGG 1 cut(s) 285
TaaI ACNGT 1 cut(s) 298
TaiI ACGT 2 cut(s) 56, 78
TaqI TCGA 1 cut(s) 217
TasI AATT 2 cut(s) 99, 212
TfiI GAWTC 1 cut(s) 84
Tru1I TTAA 1 cut(s) 306
Tru9I TTAA 1 cut(s) 306
TseFI GTSAC 1 cut(s) 292
Tsp45I GTSAC 1 cut(s) 292
TspGWI ACGGA 1 cut(s) 248
XagI CCTNNNNNAGG 1 cut(s) 284
XapI RAATTY 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.