Rmu_co8452475.1_g000001

nucleobase-ascorbate transporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8452475.1
OG0011640
Physical Location & Seq
Forward (+)
691 .. 1327
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8452475.1_g000001.1.cds

Sequence Viewer

Length: 471 bp
atggcccaatgcggtggtggcaacagcgacaagagtaatggcggtggtggttgtacttgtagtggcaagaagaagatcaatggtgatggtggccgcgacaaaaagttcgaggagttgcagccacacccaataaaagagcagttaccaggagttcagtactgtgttaacagtcctcctccatggactgaagctatagtgttgggtttccagcactatcttttaactcttggtattactgtcttgattccaaacacaattgttcctcatatgggcggaggcgatgttgagaaggctaaggtggtacaaaccatgctctttctttcagggttgaacacactcttgcaatctctatttgggaccagacttccctcggtggtagtgggatcatatacttatgtactccccacaacttcaataatcctagccaatagatacaaggcattcacagatcctcatgaggtgatcaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Xan_ur_permease

Protein Analysis

156

Amino Acids

16.7

Weight (kDa)

8.35

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011640)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65550 AT5G25420
fragaria_vesca FvH4_2g32910
malus_domestica MD04G1056000.v1.1 MD15G1067600.v1.1
prunus_persica Prupe.1G421500_v2.0.a1
pyrus_communis pycom04g04930
rosa_chinensis RchiOBHm_Chr6g0309811
rosa_laevigata RLG00000010534
rosa_multiflora Rmu_co8452475.1_g000001 Rmu_sc0011006.1_g000001 Rmu_ssc0000373.1_g000005
rosa_roxburghii Rroxscaffold_7G00159160
rosa_rugosa Rorug06G0375000
rosa_samantha Rh6AG488300 Rh6BG497900 Rh6CG502700 Rh6DG488800
rosa_wichuraiana Rw6G042530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 96
AciI CCGC 4 cut(s) 12, 42, 94, 273
AclWI GGATC 2 cut(s) 391, 443
AcoI YGGCCR 1 cut(s) 91
AcuI CTGAAG 1 cut(s) 207
AfaI GTAC 4 cut(s) 55, 158, 303, 399
AfiI CCNNNNNNNGG 1 cut(s) 269
AgsI TTSAA 2 cut(s) 331, 414
AjnI CCWGG 1 cut(s) 145
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
AlwI GGATC 2 cut(s) 391, 443
AoxI GGCC 2 cut(s) 3, 91
ApeKI GCWGC 1 cut(s) 118
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
AspS9I GGNCC 2 cut(s) 4, 357
AsuHPI GGTGA 1 cut(s) 95
AvaII GGWCC 1 cut(s) 357
BbvI GCAGC 1 cut(s) 130
BccI CCATC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 147
BclI TGATCA 1 cut(s) 462
BfaI CTAG 2 cut(s) 422, 469
BfmI CTRYAG 1 cut(s) 192
BisI GCNGC 2 cut(s) 94, 119
BlsI GCNGC 2 cut(s) 95, 120
BmcAI AGTACT 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 357
BmgT120I GGNCC 2 cut(s) 4, 357
BmiI GGNNCC 1 cut(s) 358
BmrFI CCNGG 1 cut(s) 147
Bpu10I CCTNAGC 1 cut(s) 294
BsaJI CCNNGG 2 cut(s) 179, 369
BsaXI ACNNNNNCTCC 2 cut(s) 267, 297
Bsc4I CCNNNNNNNGG 1 cut(s) 269
BseBI CCWGG 1 cut(s) 147
BseDI CCNNGG 2 cut(s) 179, 369
BseLI CCNNNNNNNGG 1 cut(s) 269
BseRI GAGGAG 2 cut(s) 125, 165
BseXI GCAGC 1 cut(s) 130
Bsh1236I CGCG 1 cut(s) 96
BshFI GGCC 2 cut(s) 5, 93
BslFI GGGAC 1 cut(s) 370
BslI CCNNNNNNNGG 1 cut(s) 269
BsmFI GGGAC 1 cut(s) 370
BsmI GAATGC 1 cut(s) 440
BsnI GGCC 2 cut(s) 5, 93
Bsp143I GATC 4 cut(s) 75, 383, 448, 462
Bsp19I CCATGG 1 cut(s) 179
BspACI CCGC 4 cut(s) 12, 42, 94, 273
BspANI GGCC 2 cut(s) 5, 93
BspFNI CGCG 1 cut(s) 96
BspHI TCATGA 1 cut(s) 454
BspLI GGNNCC 1 cut(s) 358
BspPI GGATC 2 cut(s) 391, 443
BssECI CCNNGG 2 cut(s) 179, 369
BssMI GATC 4 cut(s) 75, 383, 448, 462
BssT1I CCWWGG 1 cut(s) 179
Bst2UI CCWGG 1 cut(s) 147
Bst4CI ACNGT 3 cut(s) 161, 170, 238
BstDEI CTNAG 1 cut(s) 294
BstDSI CCRYGG 1 cut(s) 179
BstFNI CGCG 1 cut(s) 96
BstKTI GATC 4 cut(s) 78, 386, 451, 465
BstMBI GATC 4 cut(s) 75, 383, 448, 462
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 147
BstSCI CCNGG 1 cut(s) 145
BstSFI CTRYAG 1 cut(s) 192
BstUI CGCG 1 cut(s) 96
BstV1I GCAGC 1 cut(s) 130
BstX2I RGATCY 1 cut(s) 448
BstXI CCANNNNNNTGG 1 cut(s) 14
BstYI RGATCY 1 cut(s) 448
BsuRI GGCC 2 cut(s) 5, 93
BtgI CCRYGG 1 cut(s) 179
BtgZI GCGATG 1 cut(s) 294
CciI TCATGA 1 cut(s) 454
Cfr13I GGNCC 2 cut(s) 4, 357
Csp6I GTAC 4 cut(s) 54, 157, 302, 398
CviAII CATG 3 cut(s) 180, 310, 455
CviJI RGCY 6 cut(s) 5, 93, 121, 191, 293, 425
CviKI_1 RGCY 6 cut(s) 5, 93, 121, 191, 293, 425
CviQI GTAC 4 cut(s) 54, 157, 302, 398
DdeI CTNAG 1 cut(s) 294
DpnI GATC 4 cut(s) 77, 385, 450, 464
DpnII GATC 4 cut(s) 75, 383, 448, 462
EaeI YGGCCR 1 cut(s) 91
EciI GGCGGA 1 cut(s) 288
Eco130I CCWWGG 1 cut(s) 179
Eco47I GGWCC 1 cut(s) 357
Eco57I CTGAAG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 145
EcoT14I CCWWGG 1 cut(s) 179
ErhI CCWWGG 1 cut(s) 179
FaeI CATG 3 cut(s) 183, 313, 458
FaiI YATR 9 cut(s) 181, 194, 267, 269, 311, 388, 390, 396, 456
FaqI GGGAC 1 cut(s) 370
FatI CATG 3 cut(s) 179, 309, 454
FauNDI CATATG 1 cut(s) 267
FbaI TGATCA 1 cut(s) 462
Fnu4HI GCNGC 2 cut(s) 94, 119
Fsp4HI GCNGC 2 cut(s) 94, 119
FspBI CTAG 2 cut(s) 422, 469
GluI GCNGC 2 cut(s) 94, 119
HaeIII GGCC 2 cut(s) 5, 93
Hin1II CATG 3 cut(s) 183, 313, 458
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
HinfI GANTC 1 cut(s) 244
HpaI GTTAAC 1 cut(s) 166
HphI GGTGA 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 166
Hpy188III TCNNGA 2 cut(s) 241, 455
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 1 cut(s) 283
HpyCH4III ACNGT 3 cut(s) 161, 170, 238
HpyCH4V TGCA 2 cut(s) 118, 343
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 1 cut(s) 294
Hsp92II CATG 3 cut(s) 183, 313, 458
Ksp22I TGATCA 1 cut(s) 462
KspAI GTTAAC 1 cut(s) 166
Kzo9I GATC 4 cut(s) 75, 383, 448, 462
LpnPI CCDG 5 cut(s) 132, 159, 221, 309, 373
Lsp1109I GCAGC 1 cut(s) 130
MaeI CTAG 2 cut(s) 422, 469
MaeIII GTNAC 1 cut(s) 141
MalI GATC 4 cut(s) 77, 385, 450, 464
MboI GATC 4 cut(s) 75, 383, 448, 462
MboII GAAGA 2 cut(s) 82, 85
MfeI CAATTG 1 cut(s) 255
MflI RGATCY 1 cut(s) 448
MluCI AATT 1 cut(s) 255
MnlI CCTC 8 cut(s) 103, 183, 186, 269, 273, 379, 451, 462
MseI TTAA 2 cut(s) 165, 221
MspR9I CCNGG 1 cut(s) 147
MunI CAATTG 1 cut(s) 255
Mva1269I GAATGC 1 cut(s) 440
MvaI CCWGG 1 cut(s) 147
MvnI CGCG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 18
NcoI CCATGG 1 cut(s) 179
NdeI CATATG 1 cut(s) 267
NdeII GATC 4 cut(s) 75, 383, 448, 462
NlaIII CATG 3 cut(s) 183, 313, 458
NlaIV GGNNCC 1 cut(s) 358
PagI TCATGA 1 cut(s) 454
PctI GAATGC 1 cut(s) 440
PfeI GAWTC 1 cut(s) 244
PkrI GCNGC 2 cut(s) 95, 120
Psp6I CCWGG 1 cut(s) 145
PspGI CCWGG 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 358
PspPI GGNCC 2 cut(s) 4, 357
PsuI RGATCY 1 cut(s) 448
RsaI GTAC 4 cut(s) 55, 158, 303, 399
RsaNI GTAC 4 cut(s) 54, 157, 302, 398
SaqAI TTAA 2 cut(s) 165, 221
SatI GCNGC 2 cut(s) 94, 119
Sau3AI GATC 4 cut(s) 75, 383, 448, 462
Sau96I GGNCC 2 cut(s) 4, 357
ScaI AGTACT 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 147
SetI ASST 3 cut(s) 193, 300, 462
SfcI CTRYAG 1 cut(s) 192
SinI GGWCC 1 cut(s) 357
Sse9I AATT 1 cut(s) 255
SsiI CCGC 4 cut(s) 12, 42, 94, 273
SspMI CTAG 2 cut(s) 422, 469
StyD4I CCNGG 1 cut(s) 145
StyI CCWWGG 1 cut(s) 179
TaaI ACNGT 3 cut(s) 161, 170, 238
TaqI TCGA 1 cut(s) 108
TasI AATT 1 cut(s) 255
TatI WGTACW 3 cut(s) 53, 156, 397
TauI GCSGC 1 cut(s) 96
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 2 cut(s) 165, 221
Tru9I TTAA 2 cut(s) 165, 221
TseI GCWGC 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 357
XcmI CCANNNNNNNNNTGG 1 cut(s) 14
XspI CTAG 2 cut(s) 422, 469
ZrmI AGTACT 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.