Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8455067.1

Orthogroup ID

OG0006405

Physical Location & Seq

Genomic Coordinates Forward (+)

696 .. 1756

Gene Structure 1061 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8455067.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1061 bp

atggacaaagctttgaaaaccaagccttgcagacttggtgatcagaataccagcgacgttgtcatctgcttgaaggacagagaaggaagacaccaacagttttactcccactcatctgttctcataaaaaggagcaagtactttgctgaacggttgtctaatccagaccgtagtaattccattaatgttcattgctctgagttcaactatgatcaccatgtcaacctgttgaggctgctctatcttccaacagagttgattttggacgcattggactctgttaagtctgctgtcggtattcttcagtcagcagtttccttcaagtgtgacgagattgtgtcctgctgcatccagtacttggaggctgttccttgggaggacaaagaagaagagcacatcttaaaagctgtatcaaagttgggtcctgtagctatgcccataatagctaggatccaacctgttgatttagctgccaccaaaactgttttgatctcagcaattcgtgtggccacatccattgttggaccatgtcctccattcggcaatgagcttaaaacttctgctcaagagcaagtcgaatacatgttaggagaagatgaggatacaccgttggtcacagcagatgatgaagtcagatcagtggtaagaacaggtctgtcacatatttgtgcaacatttgaaaaggatctgtcttccttacttttggagccagaccttgcatccgagacagcagatgagaaaataatgcatagtttatcggatcttgaatggatgtgtagcatactgggaaagatggatttgatgaaggatttcgtttccaactgggctgaaagctccagtaatgttttaggagtgatcgaggacaagaaacttgattcgtttatgtggggcttgaagattaagctcatagaagtgactgctaaagtcttggaagcagttgggtatggtaatgtgattcttccagctccaattcgcttgacattactgaagtcatggctcccttatattaggaagatgaagccactcttggataaaaggggcagcgaggacacaggttttcc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BTB

Protein Analysis

354

Amino Acids

39.52

Weight (kDa)

5.31

Isoelectric Point (pI)

42.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006405)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g07840 FvH4_4g07840 FvH4_4g07840 FvH4_4g07840 FvH4_4g07840 FvH4_5g11380 FvH4_5g11380
malus_domestica	MD06G1114200.v1.1 MD14G1135500.v1.1
prunus_persica	Prupe.5G127000_v2.0.a1 Prupe.5G127000_v2.0.a1
pyrus_communis	pycom06g10680 pycom14g10870
rosa_chinensis	RchiOBHm_Chr7g0186491
rosa_laevigata	RLG00000004841
rosa_multiflora	Rmu_co8455067.1_g000001 Rmu_sc0000645.1_g000031
rosa_roxburghii	Rroxscaffold_3G00268100 Rroxscaffold_4G00302490
rosa_rugosa	Rorug06G0474700
rosa_samantha	Rh6CG051800 Rh7AG066600 Rh7BG082400 Rh7CG081200 Rh7DG082000
rosa_wichuraiana	Rw7G006820 Rw7G007060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	358
AclWI	GGATC	4 cut(s)	445, 458, 693, 768
AcoI	YGGCCR	1 cut(s)	507
AcuI	CTGAAG	2 cut(s)	287, 1007
AfaI	GTAC	2 cut(s)	140, 356
AfiI	CCNNNNNNNGG	2 cut(s)	358, 539
AflIII	ACRYGT	1 cut(s)	582
AgsI	TTSAA	7 cut(s)	16, 73, 205, 322, 680, 767, 895
AjuI	GAANNNNNNNTTGG	2 cut(s)	1010, 1042
AluBI	AGCT	9 cut(s)	11, 407, 431, 446, 470, 550, 834, 904, 965
AluI	AGCT	9 cut(s)	11, 407, 431, 446, 470, 550, 834, 904, 965
Alw21I	GWGCWC	1 cut(s)	396
Alw26I	GTCTC	1 cut(s)	719
AlwI	GGATC	4 cut(s)	445, 458, 693, 768
AoxI	GGCC	1 cut(s)	507
ApeKI	GCWGC	4 cut(s)	235, 345, 470, 1041
AseI	ATTAAT	1 cut(s)	183
Asp700I	GAANNNNTTC	1 cut(s)	809
AspS9I	GGNCC	2 cut(s)	422, 524
AsuHPI	GGTGA	2 cut(s)	50, 206
AvaII	GGWCC	2 cut(s)	422, 524
BalI	TGGCCA	1 cut(s)	509
BamHI	GGATCC	1 cut(s)	450
BbsI	GAAGAC	2 cut(s)	94, 684
Bbv12I	GWGCWC	1 cut(s)	396
BbvI	GCAGC	4 cut(s)	222, 332, 457, 1053
BccI	CCATC	1 cut(s)	787
BciVI	GTATCC	1 cut(s)	595
BclI	TGATCA	2 cut(s)	40, 211
BcoDI	GTCTC	1 cut(s)	719
BfaI	CTAG	1 cut(s)	447
BfmI	CTRYAG	1 cut(s)	426
BfuI	GTATCC	1 cut(s)	595
BisI	GCNGC	4 cut(s)	236, 346, 471, 1042
BlsI	GCNGC	4 cut(s)	237, 347, 472, 1043
BmcAI	AGTACT	2 cut(s)	140, 356
Bme18I	GGWCC	2 cut(s)	422, 524
BmgT120I	GGNCC	2 cut(s)	422, 524
BmiI	GGNNCC	4 cut(s)	423, 452, 708, 998
BmrI	ACTGGG	2 cut(s)	794, 832
BmsI	GCATC	2 cut(s)	357, 728
BmuI	ACTGGG	2 cut(s)	794, 832
BpiI	GAAGAC	2 cut(s)	94, 684
BpmI	CTGGAG	1 cut(s)	820
BpuEI	CTTGAG	1 cut(s)	549
BsaJI	CCNNGG	1 cut(s)	371
Bsc4I	CCNNNNNNNGG	2 cut(s)	358, 539
Bse1I	ACTGG	4 cut(s)	352, 789, 827, 837
Bse3DI	GCAATG	2 cut(s)	190, 550
BseDI	CCNNGG	1 cut(s)	371
BseGI	GGATG	4 cut(s)	348, 512, 719, 777
BseLI	CCNNNNNNNGG	2 cut(s)	358, 539
BseMI	GCAATG	2 cut(s)	190, 550
BseMII	CTCAG	2 cut(s)	189, 507
BseNI	ACTGG	4 cut(s)	352, 789, 827, 837
BseXI	GCAGC	4 cut(s)	222, 332, 457, 1053
BshFI	GGCC	1 cut(s)	509
BsiHKAI	GWGCWC	1 cut(s)	396
BslI	CCNNNNNNNGG	2 cut(s)	358, 539
BsmAI	GTCTC	1 cut(s)	719
BsnI	GGCC	1 cut(s)	509
Bsp1286I	GDGCHC	1 cut(s)	396
Bsp143I	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
BspANI	GGCC	1 cut(s)	509
BspCNI	CTCAG	2 cut(s)	190, 506
BspLI	GGNNCC	4 cut(s)	423, 452, 708, 998
BspPI	GGATC	4 cut(s)	445, 458, 693, 768
BspQI	GCTCTTC	1 cut(s)	384
BsrDI	GCAATG	2 cut(s)	190, 550
BsrI	ACTGG	4 cut(s)	352, 789, 827, 837
BssECI	CCNNGG	1 cut(s)	371
BssMI	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
BssT1I	CCWWGG	1 cut(s)	371
Bst4CI	ACNGT	5 cut(s)	99, 153, 170, 484, 609
Bst6I	CTCTTC	1 cut(s)	384
BstDEI	CTNAG	2 cut(s)	198, 493
BstF5I	GGATG	4 cut(s)	348, 512, 719, 777
BstKTI	GATC	8 cut(s)	43, 214, 453, 492, 638, 688, 763, 858
BstMAI	GTCTC	1 cut(s)	719
BstMBI	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
BstNSI	RCATGY	1 cut(s)	586
BstSFI	CTRYAG	1 cut(s)	426
BstV1I	GCAGC	4 cut(s)	222, 332, 457, 1053
BstV2I	GAAGAC	2 cut(s)	94, 684
BstX2I	RGATCY	3 cut(s)	450, 685, 760
BstYI	RGATCY	3 cut(s)	450, 685, 760
BsuI	GTATCC	1 cut(s)	595
BsuRI	GGCC	1 cut(s)	509
BtsCI	GGATG	4 cut(s)	348, 512, 719, 777
BtsIMutI	CAGTG	1 cut(s)	645
Cfr13I	GGNCC	2 cut(s)	422, 524
CseI	GACGC	1 cut(s)	275
Csp6I	GTAC	2 cut(s)	139, 355
CspCI	CAANNNNNGTGG	4 cut(s)	486, 499, 521, 534
CviAII	CATG	4 cut(s)	218, 528, 583, 993
CviQI	GTAC	2 cut(s)	139, 355
DdeI	CTNAG	2 cut(s)	198, 493
DpnI	GATC	8 cut(s)	42, 213, 452, 491, 637, 687, 762, 857
DpnII	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
EaeI	YGGCCR	1 cut(s)	507
Eam1104I	CTCTTC	1 cut(s)	384
EarI	CTCTTC	1 cut(s)	384
Eco130I	CCWWGG	1 cut(s)	371
Eco47I	GGWCC	2 cut(s)	422, 524
Eco57I	CTGAAG	2 cut(s)	287, 1007
EcoO109I	RGGNCCY	1 cut(s)	422
EcoT14I	CCWWGG	1 cut(s)	371
EcoT22I	ATGCAT	1 cut(s)	750
ErhI	CCWWGG	1 cut(s)	371
FaeI	CATG	4 cut(s)	221, 531, 586, 996
FalI	AAGNNNNNCTT	2 cut(s)	1010, 1042
FatI	CATG	4 cut(s)	217, 527, 582, 992
FbaI	TGATCA	2 cut(s)	40, 211
Fnu4HI	GCNGC	4 cut(s)	236, 346, 471, 1042
FokI	GGATG	4 cut(s)	335, 499, 706, 784
Fsp4HI	GCNGC	4 cut(s)	236, 346, 471, 1042
FspBI	CTAG	1 cut(s)	447
GluI	GCNGC	4 cut(s)	236, 346, 471, 1042
GsuI	CTGGAG	1 cut(s)	820
HaeIII	GGCC	1 cut(s)	509
HgaI	GACGC	1 cut(s)	275
Hin1II	CATG	4 cut(s)	221, 531, 586, 996
HincII	GTYRAC	1 cut(s)	223
HindII	GTYRAC	1 cut(s)	223
HindIII	AAGCTT	1 cut(s)	9
HinfI	GANTC	3 cut(s)	275, 875, 955
HphI	GGTGA	2 cut(s)	50, 206
Hpy166II	GTNNAC	1 cut(s)	223
Hpy188I	TCNGA	5 cut(s)	45, 199, 635, 724, 760
Hpy188III	TCNNGA	3 cut(s)	164, 566, 764
Hpy8I	GTNNAC	1 cut(s)	223
Hpy99I	CGWCG	1 cut(s)	59
HpyAV	CCTTC	4 cut(s)	67, 77, 328, 799
HpyCH4III	ACNGT	5 cut(s)	99, 153, 170, 484, 609
HpyCH4IV	ACGT	1 cut(s)	57
HpyCH4V	TGCA	5 cut(s)	30, 348, 671, 719, 748
HpyF3I	CTNAG	2 cut(s)	198, 493
HpySE526I	ACGT	1 cut(s)	57
Hsp92II	CATG	4 cut(s)	221, 531, 586, 996
Ksp22I	TGATCA	2 cut(s)	40, 211
Kzo9I	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
LguI	GCTCTTC	1 cut(s)	384
LmnI	GCTCC	5 cut(s)	132, 706, 839, 970, 1002
Lsp1109I	GCAGC	4 cut(s)	222, 332, 457, 1053
LweI	GCATC	2 cut(s)	357, 728
MaeI	CTAG	1 cut(s)	447
MaeII	ACGT	1 cut(s)	57
MaeIII	GTNAC	4 cut(s)	326, 613, 657, 913
MalI	GATC	8 cut(s)	42, 213, 452, 491, 637, 687, 762, 857
MboI	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
MflI	RGATCY	3 cut(s)	450, 685, 760
MhlI	GDGCHC	1 cut(s)	396
MlsI	TGGCCA	1 cut(s)	509
MluCI	AATT	3 cut(s)	175, 498, 969
MluNI	TGGCCA	1 cut(s)	509
MlyI	GAGTC	1 cut(s)	269
MmeI	TCCRAC	4 cut(s)	272, 478, 502, 843
MnlI	CCTC	7 cut(s)	225, 355, 370, 543, 592, 853, 1039
Mox20I	TGGCCA	1 cut(s)	509
Mph1103I	ATGCAT	1 cut(s)	750
MroXI	GAANNNNTTC	1 cut(s)	809
MscI	TGGCCA	1 cut(s)	509
MseI	TTAA	5 cut(s)	183, 282, 401, 552, 900
MslI	CAYNNNNRTG	2 cut(s)	666, 911
Msp20I	TGGCCA	1 cut(s)	509
NdeII	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
NlaIII	CATG	4 cut(s)	221, 531, 586, 996
NlaIV	GGNNCC	4 cut(s)	423, 452, 708, 998
NmuCI	GTSAC	4 cut(s)	326, 613, 657, 913
NsiI	ATGCAT	1 cut(s)	750
NspI	RCATGY	1 cut(s)	586
PciI	ACATGT	1 cut(s)	582
PciSI	GCTCTTC	1 cut(s)	384
PdmI	GAANNNNTTC	1 cut(s)	809
PfeI	GAWTC	2 cut(s)	875, 955
PflFI	GACNNNGTC	2 cut(s)	59, 528
PflMI	CCANNNNNTGG	1 cut(s)	358
PkrI	GCNGC	4 cut(s)	237, 347, 472, 1043
PleI	GAGTC	1 cut(s)	269
PpsI	GAGTC	1 cut(s)	269
PpuMI	RGGWCCY	1 cut(s)	422
PscI	ACATGT	1 cut(s)	582
PshBI	ATTAAT	1 cut(s)	183
Psp5II	RGGWCCY	1 cut(s)	422
PspN4I	GGNNCC	4 cut(s)	423, 452, 708, 998
PspPI	GGNCC	2 cut(s)	422, 524
PspPPI	RGGWCCY	1 cut(s)	422
PsuI	RGATCY	3 cut(s)	450, 685, 760
PsyI	GACNNNGTC	2 cut(s)	59, 528
RsaI	GTAC	2 cut(s)	140, 356
RsaNI	GTAC	2 cut(s)	139, 355
RseI	CAYNNNNRTG	2 cut(s)	666, 911
SapI	GCTCTTC	1 cut(s)	384
SaqAI	TTAA	5 cut(s)	183, 282, 401, 552, 900
SatI	GCNGC	4 cut(s)	236, 346, 471, 1042
Sau3AI	GATC	8 cut(s)	40, 211, 450, 489, 635, 685, 760, 855
Sau96I	GGNCC	2 cut(s)	422, 524
ScaI	AGTACT	2 cut(s)	140, 356
SchI	GAGTC	1 cut(s)	269
SduI	GDGCHC	1 cut(s)	396
SfaNI	GCATC	2 cut(s)	357, 728
SfcI	CTRYAG	1 cut(s)	426
SinI	GGWCC	2 cut(s)	422, 524
SmiMI	CAYNNNNRTG	2 cut(s)	666, 911
SmlI	CTYRAG	1 cut(s)	564
SmoI	CTYRAG	1 cut(s)	564
Sse9I	AATT	3 cut(s)	175, 498, 969
SspMI	CTAG	1 cut(s)	447
StyI	CCWWGG	1 cut(s)	371
TaaI	ACNGT	5 cut(s)	99, 153, 170, 484, 609
TaiI	ACGT	1 cut(s)	60
TaqI	TCGA	2 cut(s)	576, 858
TasI	AATT	3 cut(s)	175, 498, 969
TatI	WGTACW	2 cut(s)	138, 354
TfiI	GAWTC	2 cut(s)	875, 955
Tru1I	TTAA	5 cut(s)	183, 282, 401, 552, 900
Tru9I	TTAA	5 cut(s)	183, 282, 401, 552, 900
TscAI	CASTG	1 cut(s)	645
TseFI	GTSAC	4 cut(s)	326, 613, 657, 913
TseI	GCWGC	4 cut(s)	235, 345, 470, 1041
Tsp45I	GTSAC	4 cut(s)	326, 613, 657, 913
TspDTI	ATGAA	4 cut(s)	179, 642, 818, 1031
TspRI	CASTG	1 cut(s)	645
Tth111I	GACNNNGTC	2 cut(s)	59, 528
Van91I	CCANNNNNTGG	1 cut(s)	358
VpaK11BI	GGWCC	2 cut(s)	422, 524
VspI	ATTAAT	1 cut(s)	183
XceI	RCATGY	1 cut(s)	586
XmnI	GAANNNNTTC	1 cut(s)	809
XspI	CTAG	1 cut(s)	447
ZrmI	AGTACT	2 cut(s)	140, 356
Zsp2I	ATGCAT	1 cut(s)	750

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.