Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8457807.1

Orthogroup ID

OG0005436

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1647

Gene Structure 1647 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8457807.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 699 bp

atgttctctcatcctcttgtttctactttctttaaattacagataacagacttgccaccaggaagaataccagtggagacattcattattcaaggaaatgaaaatgggtatgaggatgcatatgagatgatgctcgatgagttaaaagaaggaggcaaagtgtatctagtgtatccagtcattgaacaatccgagcagctgcctcaactccgtgcagcttctgcggattttgaagctatatctcataggtttcagggctacagctgtggattgttgcatggaaaaatgaagagtgatgagaaagatgaagcactgagaaagtttaggtctggagaaacaaatatacttcttgccacacaagtaattgagattggtgttgatgtcccagatgcatctatgatggttgttatgaatgctgagaggtttgggattgctcagttacatcagcttagaggacgagttggacgaggtgtgagaaagtccaagtgtatactgttagcatcttctgagagtagcctaccacggctgaaggtccttgggaaatcatcagatgggttttacttggcgaatatggaccttcttttacgtggacctggtaacttgcttggcaagaaacagtcgggacatcttccagagtttcctattgcaagattggaaatagatggcaatatcttacaagaagcacaccttgctgctctg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03440 map03440

Pfam Domains

Protein Families

DEAD Helicase_C

Protein Analysis

233

Amino Acids

25.81

Weight (kDa)

6.09

Isoelectric Point (pI)

43.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005436)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G01440
fragaria_vesca	FvH4_4g32470 FvH4_4g32470
malus_domestica	MD13G1025100.v1.1 MD16G1027600.v1.1 MD16G1027700.v1.1
prunus_persica	Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1 Prupe.1G325100_v2.0.a1
pyrus_communis	pycom13g02340 pycom16g02340
rosa_chinensis	RchiOBHm_Chr4g0441331
rosa_laevigata	RLG00000006101
rosa_multiflora	Rmu_co8457807.1_g000001
rosa_roxburghii	Rroxscaffold_5G00382220
rosa_rugosa	Rorug04G0332400
rosa_samantha	Rh4AG384400 Rh4BG398500 Rh4CG413600 Rh4DG391100
rosa_wichuraiana	Rw4G033180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	490
AciI	CCGC	1 cut(s)	224
AcuI	CTGAAG	1 cut(s)	548
AgsI	TTSAA	3 cut(s)	92, 185, 233
AjnI	CCWGG	2 cut(s)	58, 592
AluBI	AGCT	5 cut(s)	199, 218, 236, 264, 448
AluI	AGCT	5 cut(s)	199, 218, 236, 264, 448
Alw26I	GTCTC	1 cut(s)	71
AlwNI	CAGNNNCTG	1 cut(s)	221
ApeKI	GCWGC	4 cut(s)	196, 199, 215, 692
AspS9I	GGNCC	3 cut(s)	532, 574, 590
AvaII	GGWCC	3 cut(s)	532, 574, 590
BbvI	GCAGC	4 cut(s)	186, 208, 227, 679
BccI	CCATC	3 cut(s)	394, 545, 656
BceAI	ACGGC	1 cut(s)	539
BciT130I	CCWGG	2 cut(s)	60, 594
BciVI	GTATCC	1 cut(s)	183
BcoDI	GTCTC	1 cut(s)	71
BfaI	CTAG	1 cut(s)	167
BfmI	CTRYAG	1 cut(s)	259
BfuI	GTATCC	1 cut(s)	183
BisI	GCNGC	4 cut(s)	197, 200, 216, 693
BlsI	GCNGC	4 cut(s)	198, 201, 217, 694
Bme1390I	CCNGG	2 cut(s)	60, 594
Bme18I	GGWCC	3 cut(s)	532, 574, 590
BmgT120I	GGNCC	3 cut(s)	532, 574, 590
BmrFI	CCNGG	2 cut(s)	60, 594
BmsI	GCATC	5 cut(s)	106, 120, 379, 401, 509
BpmI	CTGGAG	1 cut(s)	351
BsaAI	YACGTR	1 cut(s)	587
BsaJI	CCNNGG	2 cut(s)	521, 535
BsaXI	ACNNNNNCTCC	2 cut(s)	144, 174
Bse1I	ACTGG	2 cut(s)	71, 176
BseBI	CCWGG	2 cut(s)	60, 594
BseDI	CCNNGG	2 cut(s)	521, 535
BseGI	GGATG	2 cut(s)	10, 121
BseMII	CTCAG	4 cut(s)	305, 408, 449, 498
BseNI	ACTGG	2 cut(s)	71, 176
BseXI	GCAGC	4 cut(s)	186, 208, 227, 679
BsgI	GTGCAG	1 cut(s)	234
BslFI	GGGAC	2 cut(s)	368, 636
BsmAI	GTCTC	1 cut(s)	71
BsmFI	GGGAC	2 cut(s)	368, 636
BsmI	GAATGC	1 cut(s)	418
BspACI	CCGC	1 cut(s)	224
BspCNI	CTCAG	4 cut(s)	306, 409, 448, 499
BsrI	ACTGG	2 cut(s)	71, 176
BssECI	CCNNGG	2 cut(s)	521, 535
BssNAI	GTATAC	1 cut(s)	491
BssT1I	CCWWGG	1 cut(s)	535
Bst1107I	GTATAC	1 cut(s)	491
Bst2UI	CCWGG	2 cut(s)	60, 594
Bst4CI	ACNGT	2 cut(s)	495, 618
Bst6I	CTCTTC	1 cut(s)	284
BstAPI	GCANNNNNTGC	2 cut(s)	221, 689
BstBAI	YACGTR	1 cut(s)	587
BstDEI	CTNAG	5 cut(s)	314, 417, 435, 449, 507
BstDSI	CCRYGG	1 cut(s)	521
BstF5I	GGATG	2 cut(s)	10, 121
BstMAI	GTCTC	1 cut(s)	71
BstMWI	GCNNNNNNNGC	2 cut(s)	221, 689
BstNI	CCWGG	2 cut(s)	60, 594
BstSCI	CCNGG	2 cut(s)	58, 592
BstSFI	CTRYAG	1 cut(s)	259
BstV1I	GCAGC	4 cut(s)	186, 208, 227, 679
BstZ17I	GTATAC	1 cut(s)	491
BsuI	GTATCC	1 cut(s)	183
BtgI	CCRYGG	1 cut(s)	521
BtsCI	GGATG	2 cut(s)	10, 121
BtsIMutI	CAGTG	2 cut(s)	78, 311
CaiI	CAGNNNCTG	1 cut(s)	221
Cfr13I	GGNCC	3 cut(s)	532, 574, 590
CsiI	ACCWGGT	1 cut(s)	592
CviAII	CATG	1 cut(s)	278
CviJI	RGCY	8 cut(s)	199, 218, 236, 258, 264, 448, 516, 526
CviKI_1	RGCY	8 cut(s)	199, 218, 236, 258, 264, 448, 516, 526
DdeI	CTNAG	5 cut(s)	314, 417, 435, 449, 507
DraI	TTTAAA	1 cut(s)	34
Eam1104I	CTCTTC	1 cut(s)	284
EarI	CTCTTC	1 cut(s)	284
Eco130I	CCWWGG	1 cut(s)	535
Eco47I	GGWCC	3 cut(s)	532, 574, 590
Eco57I	CTGAAG	1 cut(s)	548
EcoO109I	RGGNCCY	1 cut(s)	532
EcoRII	CCWGG	2 cut(s)	58, 592
EcoT14I	CCWWGG	1 cut(s)	535
EcoT22I	ATGCAT	2 cut(s)	121, 394
ErhI	CCWWGG	1 cut(s)	535
FaeI	CATG	1 cut(s)	281
FalI	AAGNNNNNCTT	1 cut(s)	672
FaqI	GGGAC	2 cut(s)	368, 636
FatI	CATG	1 cut(s)	277
FauNDI	CATATG	1 cut(s)	121
FblI	GTMKAC	1 cut(s)	490
Fnu4HI	GCNGC	4 cut(s)	197, 200, 216, 693
FokI	GGATG	1 cut(s)	128
Fsp4HI	GCNGC	4 cut(s)	197, 200, 216, 693
FspBI	CTAG	1 cut(s)	167
GluI	GCNGC	4 cut(s)	197, 200, 216, 693
GsuI	CTGGAG	1 cut(s)	351
Hin1II	CATG	1 cut(s)	281
Hpy166II	GTNNAC	2 cut(s)	491, 590
Hpy188I	TCNGA	3 cut(s)	193, 508, 550
Hpy188III	TCNNGA	3 cut(s)	330, 621, 632
Hpy8I	GTNNAC	2 cut(s)	491, 590
HpyAV	CCTTC	3 cut(s)	143, 523, 587
HpyCH4III	ACNGT	2 cut(s)	495, 618
HpyCH4IV	ACGT	1 cut(s)	586
HpyCH4V	TGCA	5 cut(s)	119, 215, 277, 392, 647
HpyF10VI	GCNNNNNNNGC	2 cut(s)	221, 689
HpyF3I	CTNAG	5 cut(s)	314, 417, 435, 449, 507
HpySE526I	ACGT	1 cut(s)	586
Hsp92II	CATG	1 cut(s)	281
Lsp1109I	GCAGC	4 cut(s)	186, 208, 227, 679
LweI	GCATC	5 cut(s)	106, 120, 379, 401, 509
MabI	ACCWGGT	1 cut(s)	592
MaeI	CTAG	1 cut(s)	167
MaeII	ACGT	1 cut(s)	586
MaeIII	GTNAC	2 cut(s)	438, 596
MboII	GAAGA	4 cut(s)	75, 301, 495, 620
MluCI	AATT	2 cut(s)	35, 363
MmeI	TCCRAC	1 cut(s)	442
MnlI	CCTC	7 cut(s)	24, 106, 146, 213, 414, 446, 461
Mph1103I	ATGCAT	2 cut(s)	121, 394
MseI	TTAA	2 cut(s)	33, 143
MspA1I	CMGCKG	2 cut(s)	199, 264
MspR9I	CCNGG	2 cut(s)	60, 594
Mva1269I	GAATGC	1 cut(s)	418
MvaI	CCWGG	2 cut(s)	60, 594
MwoI	GCNNNNNNNGC	2 cut(s)	221, 689
NdeI	CATATG	1 cut(s)	121
NlaIII	CATG	1 cut(s)	281
NsiI	ATGCAT	2 cut(s)	121, 394
PcsI	WCGNNNNNNNCGW	1 cut(s)	463
PctI	GAATGC	1 cut(s)	418
PkrI	GCNGC	4 cut(s)	198, 201, 217, 694
Ppu21I	YACGTR	1 cut(s)	587
PpuMI	RGGWCCY	1 cut(s)	532
Psp5II	RGGWCCY	1 cut(s)	532
Psp6I	CCWGG	2 cut(s)	58, 592
PspGI	CCWGG	2 cut(s)	58, 592
PspPI	GGNCC	3 cut(s)	532, 574, 590
PspPPI	RGGWCCY	1 cut(s)	532
PstNI	CAGNNNCTG	1 cut(s)	221
PvuII	CAGCTG	2 cut(s)	199, 264
SaqAI	TTAA	2 cut(s)	33, 143
SatI	GCNGC	4 cut(s)	197, 200, 216, 693
Sau96I	GGNCC	3 cut(s)	532, 574, 590
ScrFI	CCNGG	2 cut(s)	60, 594
SexAI	ACCWGGT	1 cut(s)	592
SfaNI	GCATC	5 cut(s)	106, 120, 379, 401, 509
SfcI	CTRYAG	1 cut(s)	259
SinI	GGWCC	3 cut(s)	532, 574, 590
Sse9I	AATT	2 cut(s)	35, 363
SsiI	CCGC	1 cut(s)	224
SspMI	CTAG	1 cut(s)	167
StyD4I	CCNGG	2 cut(s)	58, 592
StyI	CCWWGG	1 cut(s)	535
TaaI	ACNGT	2 cut(s)	495, 618
TaiI	ACGT	1 cut(s)	589
TaqI	TCGA	1 cut(s)	135
TasI	AATT	2 cut(s)	35, 363
Tru1I	TTAA	2 cut(s)	33, 143
Tru9I	TTAA	2 cut(s)	33, 143
TscAI	CASTG	2 cut(s)	78, 318
TseI	GCWGC	4 cut(s)	196, 199, 215, 692
TspDTI	ATGAA	5 cut(s)	73, 114, 302, 321, 425
TspGWI	ACGGA	1 cut(s)	200
TspRI	CASTG	2 cut(s)	78, 318
VpaK11BI	GGWCC	3 cut(s)	532, 574, 590
XmiI	GTMKAC	1 cut(s)	490
XspI	CTAG	1 cut(s)	167
Zsp2I	ATGCAT	2 cut(s)	121, 394

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.