Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8490643.1

Orthogroup ID

OG0009279

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 933

Gene Structure 933 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8490643.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 562 bp

atgtttaacaatggacagcctgcaaagactgagatcatagattccagcttagaatcttggagaattgctgctggctactctgaaaacaagaaaacgtcaagcgagagtaattcagaaagcagtaggcaatcggaggccaaaggacaaggtcctgaagaaaaggaaacatcaagaatgacttctaacaatgaacagcctgcaaatactattactatgaattccagctctgattctttgggacttgcagctggattcaccgaaaagaagtttacgtcaagtaatagtagtacagaaagcagtaggcagtgtgaggcaaaaggtcaaggtgtagttcctgaagaaaaggaatcatcatgtatgatcaacaacaaacagcctgcacaaactagtatcatgggctccagcccatattctttgaaacttacagctggctacattgacaagaaaacaacaagcagttgtgattcagaaagcactaggccatgggaggccaaaggactaggttttcttactgaagaaaaggaaatgattccaactgcatcttcgcactatgaaggaaatc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

187

Amino Acids

20.2

Weight (kDa)

5.02

Isoelectric Point (pI)

73.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009279)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G41550
fragaria_vesca	FvH4_6g24470 FvH4_6g24470 FvH4_6g24470
prunus_persica	Prupe.7G054000_v2.0.a1
pyrus_communis	pycom14g06580
rosa_chinensis	RchiOBHm_Chr3g0483481
rosa_laevigata	RLG00000023277
rosa_multiflora	Rmu_co8490643.1_g000001 Rmu_sc0005045.1_g000039 Rmu_sc0007722.1_g000003 Rmu_sc0007793.1_g000029
rosa_roxburghii	Rroxscaffold_6G00398290
rosa_rugosa	Rorug03G0205900 Rorug03G0206000 Rorug03G0206100
rosa_samantha	Rh3AG254700 Rh3BG292000 Rh3CG289100 Rh3DG284900 Rh3DG285500
rosa_wichuraiana	Rw3G023010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	217
AcuI	CTGAAG	3 cut(s)	174, 357, 534
AfaI	GTAC	1 cut(s)	289
AgsI	TTSAA	1 cut(s)	418
AhlI	ACTAGT	1 cut(s)	386
AjuI	GAANNNNNNNTTGG	2 cut(s)	526, 558
AluBI	AGCT	4 cut(s)	48, 225, 248, 428
AluI	AGCT	4 cut(s)	48, 225, 248, 428
AoxI	GGCC	3 cut(s)	135, 479, 489
ApeKI	GCWGC	2 cut(s)	68, 245
ApoI	RAATTY	1 cut(s)	217
Asp700I	GAANNNNTTC	2 cut(s)	178, 528
AspS9I	GGNCC	1 cut(s)	149
AsuHPI	GGTGA	1 cut(s)	247
AvaII	GGWCC	1 cut(s)	149
BanII	GRGCYC	1 cut(s)	401
BbvI	GCAGC	2 cut(s)	55, 257
BclI	TGATCA	1 cut(s)	360
BcuI	ACTAGT	1 cut(s)	386
BfaI	CTAG	3 cut(s)	387, 477, 500
BisI	GCNGC	2 cut(s)	69, 246
BlsI	GCNGC	2 cut(s)	70, 247
Bme18I	GGWCC	1 cut(s)	149
BmgT120I	GGNCC	1 cut(s)	149
BmiI	GGNNCC	1 cut(s)	400
BmsI	GCATC	1 cut(s)	548
BpmI	CTGGAG	1 cut(s)	385
BsaJI	CCNNGG	1 cut(s)	482
BseDI	CCNNGG	1 cut(s)	482
BseMII	CTCAG	1 cut(s)	21
BseXI	GCAGC	2 cut(s)	55, 257
BsgI	GTGCAG	1 cut(s)	363
BshFI	GGCC	3 cut(s)	137, 481, 491
BslFI	GGGAC	1 cut(s)	252
BsmFI	GGGAC	1 cut(s)	252
BsnI	GGCC	3 cut(s)	137, 481, 491
Bsp1286I	GDGCHC	1 cut(s)	401
Bsp143I	GATC	2 cut(s)	33, 360
Bsp19I	CCATGG	1 cut(s)	482
BspANI	GGCC	3 cut(s)	137, 481, 491
BspCNI	CTCAG	1 cut(s)	22
BspLI	GGNNCC	1 cut(s)	400
BssECI	CCNNGG	1 cut(s)	482
BssMI	GATC	2 cut(s)	33, 360
BssT1I	CCWWGG	1 cut(s)	482
BstC8I	GCNNGC	5 cut(s)	21, 73, 198, 378, 430
BstDEI	CTNAG	2 cut(s)	30, 49
BstDSI	CCRYGG	1 cut(s)	482
BstKTI	GATC	2 cut(s)	36, 363
BstMBI	GATC	2 cut(s)	33, 360
BstV1I	GCAGC	2 cut(s)	55, 257
BsuRI	GGCC	3 cut(s)	137, 481, 491
BtgI	CCRYGG	1 cut(s)	482
BtsI	GCAGTG	1 cut(s)	311
BtsIMutI	CAGTG	1 cut(s)	311
Cac8I	GCNNGC	5 cut(s)	21, 73, 198, 378, 430
Cfr13I	GGNCC	1 cut(s)	149
Csp6I	GTAC	1 cut(s)	288
CviAII	CATG	3 cut(s)	354, 394, 483
CviQI	GTAC	1 cut(s)	288
DdeI	CTNAG	2 cut(s)	30, 49
DpnI	GATC	2 cut(s)	35, 362
DpnII	GATC	2 cut(s)	33, 360
Eco130I	CCWWGG	1 cut(s)	482
Eco24I	GRGCYC	1 cut(s)	401
Eco47I	GGWCC	1 cut(s)	149
Eco57I	CTGAAG	3 cut(s)	174, 357, 534
EcoO109I	RGGNCCY	1 cut(s)	149
EcoRI	GAATTC	1 cut(s)	217
EcoT14I	CCWWGG	1 cut(s)	482
EcoT38I	GRGCYC	1 cut(s)	401
ErhI	CCWWGG	1 cut(s)	482
FaeI	CATG	3 cut(s)	357, 397, 486
FaiI	YATR	8 cut(s)	38, 215, 355, 359, 395, 409, 484, 552
FalI	AAGNNNNNCTT	2 cut(s)	163, 195
FaqI	GGGAC	1 cut(s)	252
FatI	CATG	3 cut(s)	353, 393, 482
FbaI	TGATCA	1 cut(s)	360
Fnu4HI	GCNGC	2 cut(s)	69, 246
FriOI	GRGCYC	1 cut(s)	401
Fsp4HI	GCNGC	2 cut(s)	69, 246
FspBI	CTAG	3 cut(s)	387, 477, 500
GluI	GCNGC	2 cut(s)	69, 246
GsuI	CTGGAG	1 cut(s)	385
HaeIII	GGCC	3 cut(s)	137, 481, 491
Hin1II	CATG	3 cut(s)	357, 397, 486
HinfI	GANTC	7 cut(s)	41, 53, 230, 252, 347, 464, 529
HphI	GGTGA	1 cut(s)	247
Hpy166II	GTNNAC	1 cut(s)	270
Hpy188I	TCNGA	5 cut(s)	82, 115, 133, 229, 469
Hpy188III	TCNNGA	3 cut(s)	152, 171, 335
Hpy8I	GTNNAC	1 cut(s)	270
HpyAV	CCTTC	1 cut(s)	548
HpyCH4IV	ACGT	2 cut(s)	95, 272
HpyCH4V	TGCA	5 cut(s)	23, 200, 245, 380, 539
HpyF3I	CTNAG	2 cut(s)	30, 49
HpySE526I	ACGT	2 cut(s)	95, 272
Hsp92II	CATG	3 cut(s)	357, 397, 486
Ksp22I	TGATCA	1 cut(s)	360
Kzo9I	GATC	2 cut(s)	33, 360
LmnI	GCTCC	1 cut(s)	404
Lsp1109I	GCAGC	2 cut(s)	55, 257
LweI	GCATC	1 cut(s)	548
MaeI	CTAG	3 cut(s)	387, 477, 500
MaeII	ACGT	2 cut(s)	95, 272
MalI	GATC	2 cut(s)	35, 362
MboI	GATC	2 cut(s)	33, 360
MboII	GAAGA	4 cut(s)	167, 350, 527, 534
MhlI	GDGCHC	1 cut(s)	401
MluCI	AATT	3 cut(s)	63, 109, 217
MmeI	TCCRAC	1 cut(s)	557
MnlI	CCTC	3 cut(s)	127, 304, 481
MroXI	GAANNNNTTC	2 cut(s)	178, 528
MseI	TTAA	1 cut(s)	6
MspA1I	CMGCKG	2 cut(s)	248, 428
NcoI	CCATGG	1 cut(s)	482
NdeII	GATC	2 cut(s)	33, 360
NlaIII	CATG	3 cut(s)	357, 397, 486
NlaIV	GGNNCC	1 cut(s)	400
PdmI	GAANNNNTTC	2 cut(s)	178, 528
PfeI	GAWTC	7 cut(s)	41, 53, 230, 252, 347, 464, 529
PflFI	GACNNNGTC	1 cut(s)	147
PkrI	GCNGC	2 cut(s)	70, 247
PpuMI	RGGWCCY	1 cut(s)	149
Psp5II	RGGWCCY	1 cut(s)	149
PspN4I	GGNNCC	1 cut(s)	400
PspPI	GGNCC	1 cut(s)	149
PspPPI	RGGWCCY	1 cut(s)	149
PsyI	GACNNNGTC	1 cut(s)	147
PvuII	CAGCTG	2 cut(s)	248, 428
RsaI	GTAC	1 cut(s)	289
RsaNI	GTAC	1 cut(s)	288
SaqAI	TTAA	1 cut(s)	6
SatI	GCNGC	2 cut(s)	69, 246
Sau3AI	GATC	2 cut(s)	33, 360
Sau96I	GGNCC	1 cut(s)	149
SduI	GDGCHC	1 cut(s)	401
SfaNI	GCATC	1 cut(s)	548
SinI	GGWCC	1 cut(s)	149
SpeI	ACTAGT	1 cut(s)	386
Sse9I	AATT	3 cut(s)	63, 109, 217
SspMI	CTAG	3 cut(s)	387, 477, 500
StyI	CCWWGG	1 cut(s)	482
TaiI	ACGT	2 cut(s)	98, 275
TasI	AATT	3 cut(s)	63, 109, 217
TatI	WGTACW	1 cut(s)	287
TfiI	GAWTC	7 cut(s)	41, 53, 230, 252, 347, 464, 529
Tru1I	TTAA	1 cut(s)	6
Tru9I	TTAA	1 cut(s)	6
TscAI	CASTG	1 cut(s)	311
TseI	GCWGC	2 cut(s)	68, 245
TspDTI	ATGAA	2 cut(s)	204, 230
TspRI	CASTG	1 cut(s)	311
Tth111I	GACNNNGTC	1 cut(s)	147
VpaK11BI	GGWCC	1 cut(s)	149
XapI	RAATTY	1 cut(s)	217
XmnI	GAANNNNTTC	2 cut(s)	178, 528
XspI	CTAG	3 cut(s)	387, 477, 500

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.