Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000050.1

Orthogroup ID

OG0010265

Physical Location & Seq

Genomic Coordinates Forward (+)

97337 .. 98109

Gene Structure 773 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000050.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 558 bp

atgatccatcccttcctgacttcagctatctctgtgcgtgctttacattatttgaaagatgtttgcaatcagcattctaaatactgcatggatggttcagcaatacgagatgaggagacaccaaatcttcaaggacatgagaggggtgaaaatcaatcgggtcctgttgaggaagttcagaaggatgaatttgagacagaatatcctgcagaggttgtctcggttcaacaagaacaagtaaagctagaaacagaagtagagcatactgagagagatttagaattcgagcaacataatggtccacgaaggcagtatcaaaaccaaagaggtggccgtggaggaggccgtcgaggttactccaatggccgtggaggccgaggcagaggaggtggtccttaccagaatggtcggaaccagttttatgaccagcctgcaaactattatccaaggaattacaataggggaagaggcggtaggggtggtggaccatcttacaacaaccatggttcagctgctcaagatggtcatgattcagctaacattggagttgcttcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1618

Protein Analysis

185

Amino Acids

20.62

Weight (kDa)

6.24

Isoelectric Point (pI)

47.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010265)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G27090
fragaria_vesca	FvH4_4g35680 FvH4_4g35680
malus_domestica	MD13G1080700.v1.1 MD16G1080200.v1.1
prunus_persica	Prupe.1G265800_v2.0.a1
pyrus_communis	pycom13g06980 pycom16g06940
rosa_chinensis	RchiOBHm_Chr4g0445281
rosa_laevigata	RLG00000005752
rosa_multiflora	Rmu_co8092570.1_g000001 Rmu_sc0000050.1_g000024 Rmu_sc0007093.1_g000001
rosa_roxburghii	Rroxscaffold_5G00385790
rosa_rugosa	Rorug04G0360000 Rorug04G0360100
rosa_samantha	Rh4AG421500 Rh4BG433400 Rh4CG448100 Rh4DG429400
rosa_wichuraiana	Rw4G036150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	471
AcoI	YGGCCR	2 cut(s)	331, 364
AcsI	RAATTY	2 cut(s)	188, 281
AcuI	CTGAAG	1 cut(s)	6
AgsI	TTSAA	3 cut(s)	55, 131, 227
AluBI	AGCT	4 cut(s)	26, 244, 512, 536
AluI	AGCT	4 cut(s)	26, 244, 512, 536
Alw26I	GTCTC	3 cut(s)	110, 188, 223
AoxI	GGCC	4 cut(s)	331, 343, 364, 373
ApeKI	GCWGC	1 cut(s)	512
ApoI	RAATTY	2 cut(s)	188, 281
AspS9I	GGNCC	4 cut(s)	161, 299, 392, 485
AsuHPI	GGTGA	1 cut(s)	158
AvaII	GGWCC	4 cut(s)	161, 299, 392, 485
BbvI	GCAGC	1 cut(s)	499
BccI	CCATC	4 cut(s)	15, 86, 496, 515
BceAI	ACGGC	3 cut(s)	318, 330, 351
BcoDI	GTCTC	3 cut(s)	110, 188, 223
BfaI	CTAG	1 cut(s)	245
BfmI	CTRYAG	1 cut(s)	207
BglI	GCCNNNNNGGC	1 cut(s)	372
BisI	GCNGC	1 cut(s)	513
BlsI	GCNGC	1 cut(s)	514
Bme18I	GGWCC	4 cut(s)	161, 299, 392, 485
BmgT120I	GGNCC	4 cut(s)	161, 299, 392, 485
BmiI	GGNNCC	2 cut(s)	162, 413
BplI	GAGNNNNNCTC	2 cut(s)	203, 235
BpuEI	CTTGAG	1 cut(s)	501
BsaJI	CCNNGG	5 cut(s)	334, 367, 376, 446, 502
Bse1I	ACTGG	1 cut(s)	415
BseDI	CCNNGG	5 cut(s)	334, 367, 376, 446, 502
BseGI	GGATG	3 cut(s)	7, 97, 190
BseMII	CTCAG	1 cut(s)	258
BseNI	ACTGG	1 cut(s)	415
BseRI	GAGGAG	3 cut(s)	128, 354, 399
BseXI	GCAGC	1 cut(s)	499
BshFI	GGCC	4 cut(s)	333, 345, 366, 375
BsmAI	GTCTC	3 cut(s)	110, 188, 223
BsmI	GAATGC	1 cut(s)	73
BsnI	GGCC	4 cut(s)	333, 345, 366, 375
Bsp143I	GATC	1 cut(s)	3
Bsp19I	CCATGG	1 cut(s)	502
BspACI	CCGC	1 cut(s)	471
BspANI	GGCC	4 cut(s)	333, 345, 366, 375
BspCNI	CTCAG	1 cut(s)	259
BspHI	TCATGA	1 cut(s)	526
BspLI	GGNNCC	2 cut(s)	162, 413
BspMAI	CTGCAG	1 cut(s)	211
BsrI	ACTGG	1 cut(s)	415
BssECI	CCNNGG	5 cut(s)	334, 367, 376, 446, 502
BssMI	GATC	1 cut(s)	3
BssT1I	CCWWGG	2 cut(s)	446, 502
Bst6I	CTCTTC	1 cut(s)	460
BstC8I	GCNNGC	2 cut(s)	39, 432
BstDEI	CTNAG	1 cut(s)	267
BstDSI	CCRYGG	3 cut(s)	334, 367, 502
BstF5I	GGATG	3 cut(s)	7, 97, 190
BstKTI	GATC	1 cut(s)	6
BstMAI	GTCTC	3 cut(s)	110, 188, 223
BstMBI	GATC	1 cut(s)	3
BstMWI	GCNNNNNNNGC	1 cut(s)	372
BstSFI	CTRYAG	1 cut(s)	207
BstV1I	GCAGC	1 cut(s)	499
BstXI	CCANNNNNNTGG	1 cut(s)	329
BsuRI	GGCC	4 cut(s)	333, 345, 366, 375
BtgI	CCRYGG	3 cut(s)	334, 367, 502
BtsCI	GGATG	3 cut(s)	7, 97, 190
Cac8I	GCNNGC	2 cut(s)	39, 432
CciI	TCATGA	1 cut(s)	526
Cfr13I	GGNCC	4 cut(s)	161, 299, 392, 485
CspCI	CAANNNNNGTGG	2 cut(s)	349, 384
CviAII	CATG	4 cut(s)	88, 137, 503, 527
CviJI	RGCY	9 cut(s)	26, 244, 333, 345, 366, 375, 430, 512, 536
CviKI_1	RGCY	9 cut(s)	26, 244, 333, 345, 366, 375, 430, 512, 536
DdeI	CTNAG	1 cut(s)	267
DpnI	GATC	1 cut(s)	5
DpnII	GATC	1 cut(s)	3
EaeI	YGGCCR	2 cut(s)	331, 364
Eam1104I	CTCTTC	1 cut(s)	460
EarI	CTCTTC	1 cut(s)	460
Eco130I	CCWWGG	2 cut(s)	446, 502
Eco47I	GGWCC	4 cut(s)	161, 299, 392, 485
Eco57I	CTGAAG	1 cut(s)	6
EcoO109I	RGGNCCY	1 cut(s)	161
EcoRI	GAATTC	1 cut(s)	281
EcoT14I	CCWWGG	2 cut(s)	446, 502
ErhI	CCWWGG	2 cut(s)	446, 502
FaeI	CATG	4 cut(s)	91, 140, 506, 530
FaiI	YATR	7 cut(s)	89, 138, 264, 294, 423, 504, 528
FatI	CATG	4 cut(s)	87, 136, 502, 526
Fnu4HI	GCNGC	1 cut(s)	513
FokI	GGATG	2 cut(s)	104, 197
Fsp4HI	GCNGC	1 cut(s)	513
FspBI	CTAG	1 cut(s)	245
GluI	GCNGC	1 cut(s)	513
HaeIII	GGCC	4 cut(s)	333, 345, 366, 375
Hin1II	CATG	4 cut(s)	91, 140, 506, 530
HinfI	GANTC	1 cut(s)	530
HphI	GGTGA	1 cut(s)	158
Hpy166II	GTNNAC	2 cut(s)	302, 485
Hpy188I	TCNGA	2 cut(s)	180, 411
Hpy188III	TCNNGA	3 cut(s)	16, 518, 527
Hpy8I	GTNNAC	2 cut(s)	302, 485
Hpy99I	CGWCG	1 cut(s)	351
HpyAV	CCTTC	3 cut(s)	22, 175, 300
HpyCH4V	TGCA	4 cut(s)	66, 87, 209, 434
HpyF10VI	GCNNNNNNNGC	1 cut(s)	372
HpyF3I	CTNAG	1 cut(s)	267
Hsp92II	CATG	4 cut(s)	91, 140, 506, 530
Kzo9I	GATC	1 cut(s)	3
LpnPI	CCDG	7 cut(s)	29, 177, 219, 413, 428, 440, 444
Lsp1109I	GCAGC	1 cut(s)	499
MaeI	CTAG	1 cut(s)	245
MaeIII	GTNAC	1 cut(s)	353
MalI	GATC	1 cut(s)	5
MboI	GATC	1 cut(s)	3
MboII	GAAGA	2 cut(s)	119, 477
MluCI	AATT	3 cut(s)	188, 281, 451
MmeI	TCCRAC	1 cut(s)	389
MseI	TTAA	1 cut(s)	556
MspA1I	CMGCKG	1 cut(s)	512
Mva1269I	GAATGC	1 cut(s)	73
MwoI	GCNNNNNNNGC	1 cut(s)	372
NcoI	CCATGG	1 cut(s)	502
NdeII	GATC	1 cut(s)	3
NlaIII	CATG	4 cut(s)	91, 140, 506, 530
NlaIV	GGNNCC	2 cut(s)	162, 413
NmeAIII	GCCGAG	1 cut(s)	401
PagI	TCATGA	1 cut(s)	526
PctI	GAATGC	1 cut(s)	73
PfeI	GAWTC	1 cut(s)	530
PkrI	GCNGC	1 cut(s)	514
PpuMI	RGGWCCY	1 cut(s)	161
Psp5II	RGGWCCY	1 cut(s)	161
PspN4I	GGNNCC	2 cut(s)	162, 413
PspPI	GGNCC	4 cut(s)	161, 299, 392, 485
PspPPI	RGGWCCY	1 cut(s)	161
PstI	CTGCAG	1 cut(s)	211
PvuII	CAGCTG	1 cut(s)	512
SaqAI	TTAA	1 cut(s)	556
SatI	GCNGC	1 cut(s)	513
Sau3AI	GATC	1 cut(s)	3
Sau96I	GGNCC	4 cut(s)	161, 299, 392, 485
SetI	ASST	8 cut(s)	28, 216, 246, 331, 355, 391, 514, 538
SfcI	CTRYAG	1 cut(s)	207
SfiI	GGCCNNNNNGGCC	1 cut(s)	372
SinI	GGWCC	4 cut(s)	161, 299, 392, 485
SmlI	CTYRAG	1 cut(s)	516
SmoI	CTYRAG	1 cut(s)	516
Sse9I	AATT	3 cut(s)	188, 281, 451
SsiI	CCGC	1 cut(s)	471
SspMI	CTAG	1 cut(s)	245
StyI	CCWWGG	2 cut(s)	446, 502
TaqI	TCGA	2 cut(s)	285, 349
TasI	AATT	3 cut(s)	188, 281, 451
TfiI	GAWTC	1 cut(s)	530
Tru1I	TTAA	1 cut(s)	556
Tru9I	TTAA	1 cut(s)	556
TseI	GCWGC	1 cut(s)	512
TspDTI	ATGAA	1 cut(s)	201
VpaK11BI	GGWCC	4 cut(s)	161, 299, 392, 485
XapI	RAATTY	2 cut(s)	188, 281
XspI	CTAG	1 cut(s)	245

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.