Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000106.1

Orthogroup ID

OG0017810

Physical Location & Seq

Genomic Coordinates Reverse (-)

98878 .. 99786

Gene Structure 909 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000106.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 423 bp

atgaaagtggctttgattggttctggtattagtggttttgtctcaacttattttcttgcaaaagaaggcgttgaagtggttctatatgagaaaaaagactactcgagtgatcatgccaggactgtcacatatgatggtgttgatttagaccttggtttcatggtcttcaatcatgtaatgtatccaaatatgatggagttctttgagagccttggagttgatatggagacatgcaacatgtccttctcagtgagtttagataaaggacggggttgtgaatggggtagtcgaaatagtctctcaagcttgtttgcagaaaagaagaacttgttcaacccatgctggaaaatgcttctagaaatcaccaagtttgaacatgatttgatcagggatctctggaaaaaagcatacttgggtccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006629 GO:0008150 GO:0008152 GO:0008168 GO:0008757 GO:0008825 GO:0009987 GO:0016740 GO:0016741 GO:0030258 GO:0032259 GO:0044237 GO:0044238 GO:0044255 GO:0044424 GO:0044444 GO:0044464 GO:0071704

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Amino_oxidase CMAS NAD_binding_8

Protein Analysis

140

Amino Acids

16.0

Weight (kDa)

5.34

Isoelectric Point (pI)

21.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017810)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0390341 RchiOBHm_Chr6g0258991
rosa_laevigata	RLG00000017320
rosa_multiflora	Rmu_sc0000106.1_g000014 Rmu_sc0007341.1_g000009
rosa_roxburghii	Rroxscaffold_5G00339910 Rroxscaffold_7G00183690 Rroxscaffold_7G00214860
rosa_samantha	Rh6BG176000 Rh6CG090500
rosa_wichuraiana	Rw0G021270 Rw5G029880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	399
AflIII	ACRYGT	1 cut(s)	237
AgsI	TTSAA	4 cut(s)	74, 169, 334, 374
AjnI	CCWGG	1 cut(s)	116
AluBI	AGCT	1 cut(s)	306
AluI	AGCT	1 cut(s)	306
Alw26I	GTCTC	3 cut(s)	46, 221, 302
AlwI	GGATC	1 cut(s)	399
Ama87I	CYCGRG	1 cut(s)	103
Asp700I	GAANNNNTTC	2 cut(s)	78, 329
AspS9I	GGNCC	1 cut(s)	416
AsuHPI	GGTGA	1 cut(s)	355
AvaI	CYCGRG	1 cut(s)	103
AvaII	GGWCC	1 cut(s)	416
BbsI	GAAGAC	1 cut(s)	157
BccI	CCATC	2 cut(s)	128, 187
BciT130I	CCWGG	1 cut(s)	118
BciVI	GTATCC	1 cut(s)	192
BclI	TGATCA	2 cut(s)	109, 384
BcoDI	GTCTC	3 cut(s)	46, 221, 302
BfaI	CTAG	1 cut(s)	356
BfuI	GTATCC	1 cut(s)	192
Bme1390I	CCNGG	1 cut(s)	118
Bme18I	GGWCC	1 cut(s)	416
BmeT110I	CYCGRG	1 cut(s)	103
BmgT120I	GGNCC	1 cut(s)	416
BmiI	GGNNCC	1 cut(s)	417
BmrFI	CCNGG	1 cut(s)	118
BpiI	GAAGAC	1 cut(s)	157
BpuEI	CTTGAG	1 cut(s)	286
BsaJI	CCNNGG	2 cut(s)	151, 211
BseBI	CCWGG	1 cut(s)	118
BseDI	CCNNGG	2 cut(s)	151, 211
BseMII	CTCAG	1 cut(s)	261
BsiHKCI	CYCGRG	1 cut(s)	103
BsmAI	GTCTC	3 cut(s)	46, 221, 302
BsoBI	CYCGRG	1 cut(s)	103
Bsp143I	GATC	3 cut(s)	109, 384, 391
BspCNI	CTCAG	1 cut(s)	260
BspLI	GGNNCC	1 cut(s)	417
BspPI	GGATC	1 cut(s)	399
BssECI	CCNNGG	2 cut(s)	151, 211
BssMI	GATC	3 cut(s)	109, 384, 391
BssT1I	CCWWGG	2 cut(s)	151, 211
Bst2UI	CCWGG	1 cut(s)	118
Bst4CI	ACNGT	1 cut(s)	124
BstDEI	CTNAG	1 cut(s)	247
BstKTI	GATC	3 cut(s)	112, 387, 394
BstMAI	GTCTC	3 cut(s)	46, 221, 302
BstMBI	GATC	3 cut(s)	109, 384, 391
BstNI	CCWGG	1 cut(s)	118
BstNSI	RCATGY	2 cut(s)	234, 241
BstSCI	CCNGG	1 cut(s)	116
BstV2I	GAAGAC	1 cut(s)	157
BstX2I	RGATCY	1 cut(s)	391
BstYI	RGATCY	1 cut(s)	391
BsuI	GTATCC	1 cut(s)	192
BtsIMutI	CAGTG	1 cut(s)	255
Cfr13I	GGNCC	1 cut(s)	416
CviAII	CATG	7 cut(s)	113, 160, 173, 231, 238, 339, 377
CviJI	RGCY	3 cut(s)	11, 210, 306
CviKI_1	RGCY	3 cut(s)	11, 210, 306
DdeI	CTNAG	1 cut(s)	247
DpnI	GATC	3 cut(s)	111, 386, 393
DpnII	GATC	3 cut(s)	109, 384, 391
Eco130I	CCWWGG	2 cut(s)	151, 211
Eco47I	GGWCC	1 cut(s)	416
Eco88I	CYCGRG	1 cut(s)	103
EcoRII	CCWGG	1 cut(s)	116
EcoT14I	CCWWGG	2 cut(s)	151, 211
ErhI	CCWWGG	2 cut(s)	151, 211
FaeI	CATG	7 cut(s)	116, 163, 176, 234, 241, 342, 380
FalI	AAGNNNNNCTT	2 cut(s)	311, 343
FatI	CATG	7 cut(s)	112, 159, 172, 230, 237, 338, 376
FauNDI	CATATG	1 cut(s)	130
FbaI	TGATCA	2 cut(s)	109, 384
FspBI	CTAG	1 cut(s)	356
Hin1II	CATG	7 cut(s)	116, 163, 176, 234, 241, 342, 380
HindIII	AAGCTT	1 cut(s)	304
HphI	GGTGA	1 cut(s)	355
Hpy188III	TCNNGA	2 cut(s)	356, 397
HpyAV	CCTTC	2 cut(s)	59, 253
HpyCH4III	ACNGT	1 cut(s)	124
HpyCH4V	TGCA	3 cut(s)	59, 234, 314
HpyF3I	CTNAG	1 cut(s)	247
Hsp92II	CATG	7 cut(s)	116, 163, 176, 234, 241, 342, 380
Ksp22I	TGATCA	2 cut(s)	109, 384
Kzo9I	GATC	3 cut(s)	109, 384, 391
LpnPI	CCDG	6 cut(s)	9, 103, 130, 328, 373, 382
MaeI	CTAG	1 cut(s)	356
MaeIII	GTNAC	1 cut(s)	124
MalI	GATC	3 cut(s)	111, 386, 393
MboI	GATC	3 cut(s)	109, 384, 391
MboII	GAAGA	2 cut(s)	157, 334
MflI	RGATCY	1 cut(s)	391
MroXI	GAANNNNTTC	2 cut(s)	78, 329
MspR9I	CCNGG	1 cut(s)	118
MvaI	CCWGG	1 cut(s)	118
NdeI	CATATG	1 cut(s)	130
NdeII	GATC	3 cut(s)	109, 384, 391
NlaIII	CATG	7 cut(s)	116, 163, 176, 234, 241, 342, 380
NlaIV	GGNNCC	1 cut(s)	417
NmuCI	GTSAC	1 cut(s)	124
NspI	RCATGY	2 cut(s)	234, 241
PaeR7I	CTCGAG	1 cut(s)	103
PciI	ACATGT	1 cut(s)	237
PdmI	GAANNNNTTC	2 cut(s)	78, 329
PscI	ACATGT	1 cut(s)	237
Psp6I	CCWGG	1 cut(s)	116
PspGI	CCWGG	1 cut(s)	116
PspN4I	GGNNCC	1 cut(s)	417
PspPI	GGNCC	1 cut(s)	416
PspXI	VCTCGAGB	1 cut(s)	103
PsuI	RGATCY	1 cut(s)	391
Sau3AI	GATC	3 cut(s)	109, 384, 391
Sau96I	GGNCC	1 cut(s)	416
ScrFI	CCNGG	1 cut(s)	118
SetI	ASST	2 cut(s)	153, 308
Sfr274I	CTCGAG	1 cut(s)	103
SinI	GGWCC	1 cut(s)	416
SlaI	CTCGAG	1 cut(s)	103
SmlI	CTYRAG	2 cut(s)	103, 301
SmoI	CTYRAG	2 cut(s)	103, 301
SspMI	CTAG	1 cut(s)	356
StyD4I	CCNGG	1 cut(s)	116
StyI	CCWWGG	2 cut(s)	151, 211
TaaI	ACNGT	1 cut(s)	124
TaqI	TCGA	2 cut(s)	104, 289
TscAI	CASTG	1 cut(s)	255
TseFI	GTSAC	1 cut(s)	124
Tsp45I	GTSAC	1 cut(s)	124
TspDTI	ATGAA	2 cut(s)	17, 148
TspRI	CASTG	1 cut(s)	255
VpaK11BI	GGWCC	1 cut(s)	416
XbaI	TCTAGA	1 cut(s)	355
XceI	RCATGY	2 cut(s)	234, 241
XhoI	CTCGAG	1 cut(s)	103
XmnI	GAANNNNTTC	2 cut(s)	78, 329
XspI	CTAG	1 cut(s)	356

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.