Rmu_sc0000124.1_g000026

Required for 40S ribosome biogenesis. Involved in nucleolar processing of pre-18S ribosomal RNA and ribosome assembly

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000124.1
Physical Location & Seq
Reverse (-)
101773 .. 103030
1258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000124.1_g000026.1.cds

Sequence Viewer

Length: 432 bp
atgacattctccacaagcaacacaaacagtgaagctaatgttgccagggctaggaaagctcttgaatatttgcaattgatgccatttctctatactcctgcggtgataaagtacatcaatggaagttttgctgaagacatcctgattgggcatcaggaaggtgggctttgctcaacatatagaatcgaatcagagcaatctcttgagcggaagatactcctctctggttctttacgggaccttgaacgactgacggggtgtgatatttggctgggtgcgaaccgcattattattatcggtacatttgaaggatcaaggctagcaagggaggttgtggaagactgcatcgttcgtaatatgcctcctgcacccaaaatcagagacctcatgacgagtctagcatcgcaggaattcgagactctgggtttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

15.97

Weight (kDa)

5.23

Isoelectric Point (pI)

45.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 208
AciI CCGC 3 cut(s) 101, 208, 283
AclWI GGATC 1 cut(s) 319
AcsI RAATTY 1 cut(s) 410
AcuI CTGAAG 1 cut(s) 153
AfaI GTAC 2 cut(s) 113, 301
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 3 cut(s) 65, 245, 308
AjnI CCWGG 1 cut(s) 44
AluBI AGCT 2 cut(s) 35, 59
AluI AGCT 2 cut(s) 35, 59
Alw26I GTCTC 2 cut(s) 375, 410
AlwI GGATC 1 cut(s) 319
ApoI RAATTY 1 cut(s) 410
AspS9I GGNCC 1 cut(s) 238
AsuHPI GGTGA 1 cut(s) 115
AsuNHI GCTAGC 1 cut(s) 319
AvaII GGWCC 1 cut(s) 238
BbsI GAAGAC 2 cut(s) 141, 345
BciT130I CCWGG 1 cut(s) 46
BcoDI GTCTC 2 cut(s) 375, 410
BfaI CTAG 3 cut(s) 51, 320, 398
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 238
BmgT120I GGNCC 1 cut(s) 238
BmiI GGNNCC 1 cut(s) 239
BmrFI CCNGG 1 cut(s) 46
BmsI GCATC 4 cut(s) 69, 160, 354, 410
BmtI GCTAGC 1 cut(s) 323
BpiI GAAGAC 2 cut(s) 141, 345
BpuEI CTTGAG 1 cut(s) 224
BsaI GGTCTC 1 cut(s) 375
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 138
BseLI CCNNNNNNNGG 1 cut(s) 51
BseRI GAGGAG 1 cut(s) 209
BseYI CCCAGC 1 cut(s) 271
BsgI GTGCAG 1 cut(s) 351
BslFI GGGAC 1 cut(s) 251
BslI CCNNNNNNNGG 1 cut(s) 51
BsmAI GTCTC 2 cut(s) 375, 410
BsmFI GGGAC 1 cut(s) 251
Bso31I GGTCTC 1 cut(s) 375
Bsp143I GATC 1 cut(s) 311
BspACI CCGC 3 cut(s) 101, 208, 283
BspHI TCATGA 1 cut(s) 387
BspLI GGNNCC 1 cut(s) 239
BspOI GCTAGC 1 cut(s) 323
BspPI GGATC 1 cut(s) 319
BspTNI GGTCTC 1 cut(s) 375
BsrBI CCGCTC 1 cut(s) 208
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 1 cut(s) 311
Bst2UI CCWGG 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 29
BstAPI GCANNNNNTGC 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 321
BstF5I GGATG 1 cut(s) 138
BstKTI GATC 1 cut(s) 314
BstMAI GTCTC 2 cut(s) 375, 410
BstMBI GATC 1 cut(s) 311
BstMWI GCNNNNNNNGC 3 cut(s) 41, 56, 79
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstV2I GAAGAC 2 cut(s) 141, 345
BtgZI GCGATG 1 cut(s) 387
BtsCI GGATG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 321
CciI TCATGA 1 cut(s) 387
Cfr13I GGNCC 1 cut(s) 238
Csp6I GTAC 2 cut(s) 112, 300
CviAII CATG 1 cut(s) 388
CviJI RGCY 6 cut(s) 35, 50, 59, 166, 271, 319
CviKI_1 RGCY 6 cut(s) 35, 50, 59, 166, 271, 319
CviQI GTAC 2 cut(s) 112, 300
DpnI GATC 1 cut(s) 313
DpnII GATC 1 cut(s) 311
Eco31I GGTCTC 1 cut(s) 375
Eco47I GGWCC 1 cut(s) 238
Eco57I CTGAAG 1 cut(s) 153
EcoO109I RGGNCCY 1 cut(s) 238
EcoRI GAATTC 1 cut(s) 410
EcoRII CCWGG 1 cut(s) 44
FaeI CATG 1 cut(s) 391
FaiI YATR 6 cut(s) 93, 178, 180, 359, 389, 430
FalI AAGNNNNNCTT 2 cut(s) 150, 182
FaqI GGGAC 1 cut(s) 251
FatI CATG 1 cut(s) 387
FokI GGATG 1 cut(s) 125
FspBI CTAG 3 cut(s) 51, 320, 398
GsaI CCCAGC 1 cut(s) 275
Hin1II CATG 1 cut(s) 391
HinfI GANTC 4 cut(s) 183, 188, 394, 418
HphI GGTGA 1 cut(s) 115
Hpy188I TCNGA 2 cut(s) 193, 380
Hpy188III TCNNGA 6 cut(s) 62, 142, 155, 203, 388, 415
HpyAV CCTTC 2 cut(s) 152, 302
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4V TGCA 3 cut(s) 73, 345, 368
HpyF10VI GCNNNNNNNGC 3 cut(s) 41, 56, 79
Hsp92II CATG 1 cut(s) 391
Kzo9I GATC 1 cut(s) 311
LweI GCATC 4 cut(s) 69, 160, 354, 410
MaeI CTAG 3 cut(s) 51, 320, 398
MalI GATC 1 cut(s) 313
MbiI CCGCTC 1 cut(s) 208
MboI GATC 1 cut(s) 311
MboII GAAGA 3 cut(s) 146, 223, 350
MfeI CAATTG 1 cut(s) 74
MluCI AATT 2 cut(s) 74, 410
MlyI GAGTC 2 cut(s) 403, 412
MnlI CCTC 4 cut(s) 230, 322, 372, 395
MspR9I CCNGG 1 cut(s) 46
MunI CAATTG 1 cut(s) 74
MvaI CCWGG 1 cut(s) 46
MwoI GCNNNNNNNGC 3 cut(s) 41, 56, 79
NdeII GATC 1 cut(s) 311
NheI GCTAGC 1 cut(s) 319
NlaIII CATG 1 cut(s) 391
NlaIV GGNNCC 1 cut(s) 239
PagI TCATGA 1 cut(s) 387
PfeI GAWTC 2 cut(s) 183, 188
PleI GAGTC 2 cut(s) 402, 412
PpsI GAGTC 2 cut(s) 402, 412
PpuMI RGGWCCY 1 cut(s) 238
Psp5II RGGWCCY 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 44
PspFI CCCAGC 1 cut(s) 271
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 239
PspPI GGNCC 1 cut(s) 238
PspPPI RGGWCCY 1 cut(s) 238
RsaI GTAC 2 cut(s) 113, 301
RsaNI GTAC 2 cut(s) 112, 300
Sau3AI GATC 1 cut(s) 311
Sau96I GGNCC 1 cut(s) 238
SchI GAGTC 2 cut(s) 403, 412
ScrFI CCNGG 1 cut(s) 46
SetI ASST 6 cut(s) 37, 61, 163, 243, 333, 387
SfaNI GCATC 4 cut(s) 69, 160, 354, 410
SinI GGWCC 1 cut(s) 238
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 74, 410
SsiI CCGC 3 cut(s) 101, 208, 283
SspI AATATT 1 cut(s) 68
SspMI CTAG 3 cut(s) 51, 320, 398
StyD4I CCNGG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 29
TaqI TCGA 2 cut(s) 186, 414
TasI AATT 2 cut(s) 74, 410
TatI WGTACW 1 cut(s) 111
TfiI GAWTC 2 cut(s) 183, 188
TscAI CASTG 1 cut(s) 34
TspRI CASTG 1 cut(s) 34
VpaK11BI GGWCC 1 cut(s) 238
XapI RAATTY 1 cut(s) 410
XspI CTAG 3 cut(s) 51, 320, 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.