Rh1CG168700

DNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
36978765 .. 36979752
988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG168700.1

Sequence Viewer

Length: 306 bp
ATGAATAGGTTTGCTTTGGGATTTTTTTTTGCTGGATCTTTTGTACATACTGACCTTGGTGGGAAGTCTGGTCGGCTCAGTGTTTGCCTATCTACTACAAATAGGCAAGTCATTGCGGGTGGAGTTGGTGGACCACTAAACTCTGCAGGACCTGTTCAGGTTATTGCTGGTACATATCTGATTAAAAGAAAAAATGATGTCAATACTGGTGTAAAAGTTGAGGCTTCTTCCCCCAGGATGCTATCACCAGGTGATGAATGTAGGCTTTCAGTTGGTAGTGGACTCTTCTGGAAGAAATATGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

10.61

Weight (kDa)

10.02

Isoelectric Point (pI)

25.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AclWI GGATC 1 cut(s) 43
AdeI CACNNNGTG 1 cut(s) 251
AfaI GTAC 2 cut(s) 45, 172
AjnI CCWGG 2 cut(s) 233, 247
AlwI GGATC 1 cut(s) 43
AlwNI CAGNNNCTG 1 cut(s) 152
AspS9I GGNCC 2 cut(s) 131, 149
AsuHPI GGTGA 2 cut(s) 237, 263
AvaII GGWCC 2 cut(s) 131, 149
BciT130I CCWGG 2 cut(s) 235, 249
BfmI CTRYAG 1 cut(s) 144
Bme1390I CCNGG 2 cut(s) 235, 249
Bme18I GGWCC 2 cut(s) 131, 149
BmgT120I GGNCC 2 cut(s) 131, 149
BmrFI CCNGG 2 cut(s) 235, 249
BmsI GCATC 1 cut(s) 228
BsaJI CCNNGG 2 cut(s) 55, 233
Bse1I ACTGG 1 cut(s) 211
Bse3DI GCAATG 1 cut(s) 111
BseBI CCWGG 2 cut(s) 235, 249
BseDI CCNNGG 2 cut(s) 55, 233
BseGI GGATG 1 cut(s) 243
BseMI GCAATG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 211
Bsp1407I TGTACA 1 cut(s) 43
Bsp143I GATC 1 cut(s) 35
BspACI CCGC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 90
BspMAI CTGCAG 1 cut(s) 148
BspPI GGATC 1 cut(s) 43
BsrDI GCAATG 1 cut(s) 111
BsrGI TGTACA 1 cut(s) 43
BsrI ACTGG 1 cut(s) 211
BssECI CCNNGG 2 cut(s) 55, 233
BssMI GATC 1 cut(s) 35
BssT1I CCWWGG 1 cut(s) 55
Bst2UI CCWGG 2 cut(s) 235, 249
Bst6I CTCTTC 1 cut(s) 290
BstAUI TGTACA 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 77
BstF5I GGATG 1 cut(s) 243
BstKTI GATC 1 cut(s) 38
BstMBI GATC 1 cut(s) 35
BstNI CCWGG 2 cut(s) 235, 249
BstSCI CCNGG 2 cut(s) 233, 247
BstSFI CTRYAG 1 cut(s) 144
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
BtsCI GGATG 1 cut(s) 243
BtsIMutI CAGTG 1 cut(s) 85
CaiI CAGNNNCTG 1 cut(s) 152
Cfr13I GGNCC 2 cut(s) 131, 149
CsiI ACCWGGT 1 cut(s) 247
Csp6I GTAC 2 cut(s) 44, 171
CviJI RGCY 3 cut(s) 76, 224, 265
CviKI_1 RGCY 3 cut(s) 76, 224, 265
CviQI GTAC 2 cut(s) 44, 171
DdeI CTNAG 1 cut(s) 77
DpnI GATC 1 cut(s) 37
DpnII GATC 1 cut(s) 35
DraIII CACNNNGTG 1 cut(s) 251
Eam1104I CTCTTC 1 cut(s) 290
EarI CTCTTC 1 cut(s) 290
Eco130I CCWWGG 1 cut(s) 55
Eco47I GGWCC 2 cut(s) 131, 149
EcoO109I RGGNCCY 1 cut(s) 149
EcoRII CCWGG 2 cut(s) 233, 247
EcoT14I CCWWGG 1 cut(s) 55
ErhI CCWWGG 1 cut(s) 55
FaiI YATR 3 cut(s) 48, 175, 300
FauI CCCGC 1 cut(s) 109
FokI GGATG 1 cut(s) 250
HinfI GANTC 1 cut(s) 282
HphI GGTGA 2 cut(s) 237, 263
Hpy166II GTNNAC 2 cut(s) 131, 281
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 1 cut(s) 289
Hpy8I GTNNAC 2 cut(s) 131, 281
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 77
Kzo9I GATC 1 cut(s) 35
LweI GCATC 1 cut(s) 228
MabI ACCWGGT 1 cut(s) 247
MalI GATC 1 cut(s) 37
MboI GATC 1 cut(s) 35
MboII GAAGA 3 cut(s) 219, 277, 304
MflI RGATCY 1 cut(s) 35
MlyI GAGTC 1 cut(s) 276
MnlI CCTC 1 cut(s) 214
MseI TTAA 1 cut(s) 183
MspR9I CCNGG 2 cut(s) 235, 249
MvaI CCWGG 2 cut(s) 235, 249
NdeII GATC 1 cut(s) 35
PleI GAGTC 1 cut(s) 276
PpsI GAGTC 1 cut(s) 276
PpuMI RGGWCCY 1 cut(s) 149
Psp5II RGGWCCY 1 cut(s) 149
Psp6I CCWGG 2 cut(s) 233, 247
PspGI CCWGG 2 cut(s) 233, 247
PspPI GGNCC 2 cut(s) 131, 149
PspPPI RGGWCCY 1 cut(s) 149
PstI CTGCAG 1 cut(s) 148
PstNI CAGNNNCTG 1 cut(s) 152
PsuI RGATCY 1 cut(s) 35
RsaI GTAC 2 cut(s) 45, 172
RsaNI GTAC 2 cut(s) 44, 171
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 1 cut(s) 35
Sau96I GGNCC 2 cut(s) 131, 149
SchI GAGTC 1 cut(s) 276
ScrFI CCNGG 2 cut(s) 235, 249
SetI ASST 5 cut(s) 11, 57, 154, 162, 253
SexAI ACCWGGT 1 cut(s) 247
SfaNI GCATC 1 cut(s) 228
SfcI CTRYAG 1 cut(s) 144
SinI GGWCC 2 cut(s) 131, 149
SsiI CCGC 1 cut(s) 116
StyD4I CCNGG 2 cut(s) 233, 247
StyI CCWWGG 1 cut(s) 55
TatI WGTACW 1 cut(s) 43
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TscAI CASTG 1 cut(s) 85
TspDTI ATGAA 2 cut(s) 17, 270
TspRI CASTG 1 cut(s) 85
VpaK11BI GGWCC 2 cut(s) 131, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.