Rmu_sc0000194.1_g000021

Protein of unknown function (DUF789)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000194.1
OG0016846
Physical Location & Seq
Forward (+)
70741 .. 73677
2937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000194.1_g000021.1.cds

Sequence Viewer

Length: 1170 bp
atgttgagtacaagattacagtttggaaatgttagtggagaggacaggtttcacattgctgggaaagcaaggaagagatgcaatcagcagcaaaagcaggccaggaaagcaaagaatgatgcaaaccagagccccaaagagagcaaagttgtggtttctgagatcaaagagactcaaaattcattggcaaagccttgttctgatcccacttcaacgccaaggagtaatcttgacaggtttttggagtctaccacgccttcagttccggcccagtatttatctaagacgacaatgagggggtcgagaacttgtgatgtggagtttcagtcttacttctctttaaatgatctttgggaatcgtttagggaatggagtgcttatggagcaggagtaccattagtccttaacaaaagtgattctgttattcaatattatgttccttatttatccggtatccaattatatggcgaatctgctgtgaagtcaagtgcaaagcaaaggcaagttggtgaggacaatgatgatgactactatttggattcaagtagtgatgcaagcagtgactatgaaattgaaaaacacatgaagactactagggagcagcagcatattcttcaccaattaaacaatgaagtttctagtagaatggacgggttgtccatacgtgatgaacaccccatattgcaagaaggcttttctagtgatgatggagaagctgggacttctcaaggcttgctttttgagtatcttgagcgggatgctccatatggccgtgaaccattggctgacaagatatcagaccttgcacgcaagtaccctaggttgaaaacattgagaagttgtgacttactgcgaggcagttggatgtcagtagcttggtatcccatatatcgaatacctatgggtccaacgttgaaagatttggatgcttgctttctgacatatcattctctttcaacacccatgaaaggtagtggaagtgaccaagctccagtgatggtgtatcccagtgaggtggatggtgtcccaaagatttcgttgcgtatttttggattggcttcatataagctcaaaggatccttgtgggcacaaaatggtgaaatcaaatcaacagttgtttcattgatgcaactatgcttaccttcatcgacgacaatgctgaagaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF789

Protein Analysis

389

Amino Acids

43.66

Weight (kDa)

7.01

Isoelectric Point (pI)

42.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016846)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g11720
malus_domestica MD06G1219600.v1.1
prunus_persica Prupe.5G224100_v2.0.a1
pyrus_communis pycom06g19600
rosa_chinensis RchiOBHm_Chr7g0186041
rosa_laevigata RLG00000004870
rosa_multiflora Rmu_sc0000194.1_g000021
rosa_roxburghii Rroxscaffold_3G00268480
rosa_rugosa Rorug06G0471800
rosa_samantha Rh7AG070100 Rh7BG086100 Rh7CG078200 Rh7DG078200
rosa_wichuraiana Rw7G006500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 754
AccI GTMKAC 1 cut(s) 248
AciI CCGC 1 cut(s) 754
AclI AACGTT 1 cut(s) 911
AclWI GGATC 3 cut(s) 197, 1071, 1084
AcoI YGGCCR 1 cut(s) 769
AcsI RAATTY 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 243
AfaI GTAC 3 cut(s) 10, 393, 815
AfiI CCNNNNNNNGG 1 cut(s) 968
AgsI TTSAA 7 cut(s) 213, 428, 543, 575, 826, 916, 957
AhdI GACNNNNNGTC 1 cut(s) 655
AjnI CCWGG 1 cut(s) 101
AluBI AGCT 4 cut(s) 716, 875, 989, 1069
AluI AGCT 4 cut(s) 716, 875, 989, 1069
Alw26I GTCTC 1 cut(s) 164
AlwI GGATC 3 cut(s) 197, 1071, 1084
AoxI GGCC 3 cut(s) 99, 267, 769
ApeKI GCWGC 3 cut(s) 88, 601, 604
ApoI RAATTY 1 cut(s) 178
AspA2I CCTAGG 1 cut(s) 818
AspS9I GGNCC 2 cut(s) 268, 905
AsuHPI GGTGA 3 cut(s) 521, 608, 1109
AvaII GGWCC 1 cut(s) 905
AvrII CCTAGG 1 cut(s) 818
BaeGI GKGCMC 1 cut(s) 1090
BaeI ACNNNNGTAYC 2 cut(s) 797, 830
BamHI GGATCC 1 cut(s) 1076
BanII GRGCYC 1 cut(s) 134
BbsI GAAGAC 1 cut(s) 593
BbvI GCAGC 3 cut(s) 100, 613, 616
BccI CCATC 3 cut(s) 701, 991, 1013
BceAI ACGGC 1 cut(s) 756
BcgI CGANNNNNNTGC 1 cut(s) 1138
BciT130I CCWGG 1 cut(s) 103
BciVI GTATCC 3 cut(s) 464, 891, 1014
BcoDI GTCTC 1 cut(s) 164
BfaI CTAG 4 cut(s) 594, 639, 699, 819
BfuI GTATCC 3 cut(s) 464, 891, 1014
BisI GCNGC 3 cut(s) 89, 602, 605
BlnI CCTAGG 1 cut(s) 818
BlsI GCNGC 3 cut(s) 90, 603, 606
Bme1390I CCNGG 1 cut(s) 103
Bme18I GGWCC 1 cut(s) 905
BmeRI GACNNNNNGTC 1 cut(s) 655
BmgT120I GGNCC 2 cut(s) 268, 905
BmiI GGNNCC 2 cut(s) 906, 1078
BmrFI CCNGG 1 cut(s) 103
BmrI ACTGGG 2 cut(s) 265, 1002
BmsI GCATC 6 cut(s) 68, 109, 541, 748, 916, 1116
BmuI ACTGGG 2 cut(s) 265, 1002
BpiI GAAGAC 1 cut(s) 593
BpmI CTGGAG 1 cut(s) 975
BpuEI CTTGAG 2 cut(s) 711, 770
BsaAI YACGTR 1 cut(s) 665
BsaJI CCNNGG 2 cut(s) 218, 818
BsaWI WCCGGW 1 cut(s) 449
BsaXI ACNNNNNCTCC 4 cut(s) 311, 341, 375, 405
Bsc4I CCNNNNNNNGG 1 cut(s) 968
Bse1I ACTGG 3 cut(s) 271, 992, 1008
Bse3DI GCAATG 1 cut(s) 54
BseBI CCWGG 1 cut(s) 103
BseDI CCNNGG 2 cut(s) 218, 818
BseGI GGATG 4 cut(s) 763, 870, 931, 1024
BseLI CCNNNNNNNGG 1 cut(s) 968
BseMI GCAATG 1 cut(s) 54
BseMII CTCAG 1 cut(s) 150
BseNI ACTGG 3 cut(s) 271, 992, 1008
BseSI GKGCMC 1 cut(s) 1090
BseXI GCAGC 3 cut(s) 100, 613, 616
BseYI CCCAGC 2 cut(s) 59, 716
BshFI GGCC 3 cut(s) 101, 269, 771
BsiSI CCGG 2 cut(s) 266, 450
BslFI GGGAC 2 cut(s) 733, 1010
BslI CCNNNNNNNGG 1 cut(s) 968
BsmAI GTCTC 1 cut(s) 164
BsmFI GGGAC 2 cut(s) 733, 1010
BsnI GGCC 3 cut(s) 101, 269, 771
Bsp1286I GDGCHC 2 cut(s) 134, 1090
Bsp143I GATC 4 cut(s) 162, 202, 346, 1076
BspACI CCGC 1 cut(s) 754
BspANI GGCC 3 cut(s) 101, 269, 771
BspCNI CTCAG 1 cut(s) 151
BspLI GGNNCC 2 cut(s) 906, 1078
BspPI GGATC 3 cut(s) 197, 1071, 1084
BsrBI CCGCTC 1 cut(s) 754
BsrDI GCAATG 1 cut(s) 54
BsrI ACTGG 3 cut(s) 271, 992, 1008
BssECI CCNNGG 2 cut(s) 218, 818
BssMI GATC 4 cut(s) 162, 202, 346, 1076
BssT1I CCWWGG 2 cut(s) 218, 818
Bst2UI CCWGG 1 cut(s) 103
Bst4CI ACNGT 2 cut(s) 21, 1114
Bst6I CTCTTC 1 cut(s) 68
BstBAI YACGTR 1 cut(s) 665
BstC8I GCNNGC 5 cut(s) 99, 556, 734, 808, 931
BstDEI CTNAG 2 cut(s) 159, 282
BstF5I GGATG 4 cut(s) 763, 870, 931, 1024
BstKTI GATC 4 cut(s) 165, 205, 349, 1079
BstMAI GTCTC 1 cut(s) 164
BstMBI GATC 4 cut(s) 162, 202, 346, 1076
BstMWI GCNNNNNNNGC 4 cut(s) 65, 94, 107, 383
BstNI CCWGG 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 101
BstSLI GKGCMC 1 cut(s) 1090
BstV1I GCAGC 3 cut(s) 100, 613, 616
BstV2I GAAGAC 1 cut(s) 593
BstX2I RGATCY 1 cut(s) 1076
BstXI CCANNNNNNTGG 2 cut(s) 464, 1015
BstYI RGATCY 1 cut(s) 1076
BsuI GTATCC 3 cut(s) 464, 891, 1014
BsuRI GGCC 3 cut(s) 101, 269, 771
BtsCI GGATG 4 cut(s) 763, 870, 931, 1024
BtsI GCAGTG 1 cut(s) 565
BtsIMutI CAGTG 3 cut(s) 565, 999, 1015
Cac8I GCNNGC 5 cut(s) 99, 556, 734, 808, 931
Cfr13I GGNCC 2 cut(s) 268, 905
Csp6I GTAC 3 cut(s) 9, 392, 814
CviAII CATG 2 cut(s) 583, 964
CviQI GTAC 3 cut(s) 9, 392, 814
DdeI CTNAG 2 cut(s) 159, 282
DpnI GATC 4 cut(s) 164, 204, 348, 1078
DpnII GATC 4 cut(s) 162, 202, 346, 1076
DraI TTTAAA 1 cut(s) 342
DriI GACNNNNNGTC 1 cut(s) 655
EaeI YGGCCR 1 cut(s) 769
Eam1104I CTCTTC 1 cut(s) 68
Eam1105I GACNNNNNGTC 1 cut(s) 655
EarI CTCTTC 1 cut(s) 68
Eco130I CCWWGG 2 cut(s) 218, 818
Eco24I GRGCYC 1 cut(s) 134
Eco32I GATATC 1 cut(s) 795
Eco47I GGWCC 1 cut(s) 905
Eco57I CTGAAG 1 cut(s) 243
EcoRII CCWGG 1 cut(s) 101
EcoRV GATATC 1 cut(s) 795
EcoT14I CCWWGG 2 cut(s) 218, 818
EcoT38I GRGCYC 1 cut(s) 134
ErhI CCWWGG 2 cut(s) 218, 818
FaeI CATG 2 cut(s) 586, 967
FalI AAGNNNNNCTT 2 cut(s) 720, 752
FaqI GGGAC 2 cut(s) 733, 1010
FatI CATG 2 cut(s) 582, 963
FauI CCCGC 1 cut(s) 747
FauNDI CATATG 1 cut(s) 766
FblI GTMKAC 1 cut(s) 248
Fnu4HI GCNGC 3 cut(s) 89, 602, 605
FokI GGATG 4 cut(s) 770, 877, 938, 1031
FriOI GRGCYC 1 cut(s) 134
Fsp4HI GCNGC 3 cut(s) 89, 602, 605
FspBI CTAG 4 cut(s) 594, 639, 699, 819
GluI GCNGC 3 cut(s) 89, 602, 605
GsaI CCCAGC 2 cut(s) 63, 720
GsuI CTGGAG 1 cut(s) 975
HaeIII GGCC 3 cut(s) 101, 269, 771
HapII CCGG 2 cut(s) 266, 450
Hin1II CATG 2 cut(s) 586, 967
HinfI GANTC 6 cut(s) 172, 245, 356, 416, 470, 539
HpaII CCGG 2 cut(s) 266, 450
HphI GGTGA 3 cut(s) 521, 608, 1109
Hpy166II GTNNAC 2 cut(s) 249, 776
Hpy188I TCNGA 4 cut(s) 160, 202, 799, 939
Hpy188III TCNNGA 3 cut(s) 230, 303, 749
Hpy8I GTNNAC 2 cut(s) 249, 776
Hpy99I CGWCG 1 cut(s) 1153
HpyAV CCTTC 3 cut(s) 267, 683, 1152
HpyCH4III ACNGT 2 cut(s) 21, 1114
HpyCH4IV ACGT 2 cut(s) 664, 911
HpyCH4V TGCA 7 cut(s) 81, 122, 491, 554, 685, 806, 1129
HpyF10VI GCNNNNNNNGC 4 cut(s) 65, 94, 107, 383
HpyF3I CTNAG 2 cut(s) 159, 282
HpySE526I ACGT 2 cut(s) 664, 911
Hsp92II CATG 2 cut(s) 586, 967
Kzo9I GATC 4 cut(s) 162, 202, 346, 1076
LmnI GCTCC 4 cut(s) 383, 598, 766, 994
Lsp1109I GCAGC 3 cut(s) 100, 613, 616
LweI GCATC 6 cut(s) 68, 109, 541, 748, 916, 1116
MaeI CTAG 4 cut(s) 594, 639, 699, 819
MaeII ACGT 2 cut(s) 664, 911
MaeIII GTNAC 3 cut(s) 560, 842, 980
MalI GATC 4 cut(s) 164, 204, 348, 1078
MbiI CCGCTC 1 cut(s) 754
MboI GATC 4 cut(s) 162, 202, 346, 1076
MboII GAAGA 3 cut(s) 85, 598, 605
MflI RGATCY 1 cut(s) 1076
MhlI GDGCHC 2 cut(s) 134, 1090
MluCI AATT 4 cut(s) 178, 458, 570, 620
MlyI GAGTC 2 cut(s) 166, 254
MmeI TCCRAC 2 cut(s) 842, 932
MnlI CCTC 5 cut(s) 34, 288, 505, 848, 1006
MseI TTAA 3 cut(s) 341, 405, 623
MspI CCGG 2 cut(s) 266, 450
MspR9I CCNGG 1 cut(s) 103
MvaI CCWGG 1 cut(s) 103
MwoI GCNNNNNNNGC 4 cut(s) 65, 94, 107, 383
NdeI CATATG 1 cut(s) 766
NdeII GATC 4 cut(s) 162, 202, 346, 1076
NlaIII CATG 2 cut(s) 586, 967
NlaIV GGNNCC 2 cut(s) 906, 1078
NmuCI GTSAC 3 cut(s) 560, 842, 980
PfeI GAWTC 4 cut(s) 356, 416, 470, 539
PkrI GCNGC 3 cut(s) 90, 603, 606
PleI GAGTC 2 cut(s) 166, 253
PpsI GAGTC 2 cut(s) 166, 253
Ppu21I YACGTR 1 cut(s) 665
Psp1406I AACGTT 1 cut(s) 911
Psp6I CCWGG 1 cut(s) 101
PspFI CCCAGC 2 cut(s) 59, 716
PspGI CCWGG 1 cut(s) 101
PspN4I GGNNCC 2 cut(s) 906, 1078
PspPI GGNCC 2 cut(s) 268, 905
PsuI RGATCY 1 cut(s) 1076
RsaI GTAC 3 cut(s) 10, 393, 815
RsaNI GTAC 3 cut(s) 9, 392, 814
SaqAI TTAA 3 cut(s) 341, 405, 623
SatI GCNGC 3 cut(s) 89, 602, 605
Sau3AI GATC 4 cut(s) 162, 202, 346, 1076
Sau96I GGNCC 2 cut(s) 268, 905
SchI GAGTC 2 cut(s) 166, 254
ScrFI CCNGG 1 cut(s) 103
SduI GDGCHC 2 cut(s) 134, 1090
SfaNI GCATC 6 cut(s) 68, 109, 541, 748, 916, 1116
SinI GGWCC 1 cut(s) 905
SmlI CTYRAG 2 cut(s) 726, 749
SmoI CTYRAG 2 cut(s) 726, 749
Sse9I AATT 4 cut(s) 178, 458, 570, 620
SsiI CCGC 1 cut(s) 754
SspI AATATT 1 cut(s) 431
SspMI CTAG 4 cut(s) 594, 639, 699, 819
StyD4I CCNGG 1 cut(s) 101
StyI CCWWGG 2 cut(s) 218, 818
TaaI ACNGT 2 cut(s) 21, 1114
TaiI ACGT 2 cut(s) 667, 914
TaqI TCGA 3 cut(s) 302, 892, 1148
TasI AATT 4 cut(s) 178, 458, 570, 620
TatI WGTACW 1 cut(s) 8
TfiI GAWTC 4 cut(s) 356, 416, 470, 539
Tru1I TTAA 3 cut(s) 341, 405, 623
Tru9I TTAA 3 cut(s) 341, 405, 623
TscAI CASTG 3 cut(s) 565, 999, 1015
TseFI GTSAC 3 cut(s) 560, 842, 980
TseI GCWGC 3 cut(s) 88, 601, 604
Tsp45I GTSAC 3 cut(s) 560, 842, 980
TspDTI ATGAA 9 cut(s) 171, 582, 599, 645, 684, 980, 1050, 1110, 1134
TspRI CASTG 3 cut(s) 565, 999, 1015
VpaK11BI GGWCC 1 cut(s) 905
XapI RAATTY 1 cut(s) 178
XmaJI CCTAGG 1 cut(s) 818
XmiI GTMKAC 1 cut(s) 248
XspI CTAG 4 cut(s) 594, 639, 699, 819
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.