Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000279.1

Orthogroup ID

OG0013780

Physical Location & Seq

Genomic Coordinates Forward (+)

182863 .. 183762

Gene Structure 900 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 900 bp

atgctatacttccacccaattttcgtgcctgcaaaacgtcgaagactcaacccgtctctgctcagtgacttcacactaccgcttgtgatatggcaatacattcttcagtacattgccgcagatgacttgcacgtaatactagagtgtagaacggtttgtaaaacttttcggaggctaattgatgatttgaatgtttattcgtgcatcaacatggccggaatatgtggtctgaacgatattcaatttcctctctcgaaagttacacaacgtgtcttttttgctcagcaatgcttagaggcgaataacccagaatcactgtttcatcaagcaatccgaaccatgaagaaatctgggaacattctgatgacgattcagtacttaaaaatggcatgcaaagaaggcacaatctatagaggtcttaacagatggattggcttccacgatgtggcctataatgtgttgtgtatgttgcatctaattcaaggaaaccatcgggtcaaaaagaataccgtggaggagatgcttagtcgattgaattggaggatcagtgggtgggatgcagaattttgccggaatgaagctcacagatggttgaacagtggttccgaaccaacacacatcgacatcttgaaacatatccctcccaactattcagtccttccaagaaaatgtacctcatgcggggaacatgagtttcaccgcccattccttcaaaacatgtggttcgttaacggggataggaaccaagctgaatgttgtgatgtatgcaagtgctatgtcgaggctgcaaatttctacaatcaaatgcgttattgggcaacagcacatcggaatctgatggattggtttggccatgagcaggccatggtccacacattgcccgtcaaacttccccaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

299

Amino Acids

35.13

Weight (kDa)

8.72

Isoelectric Point (pI)

47.55

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
F-box	PF00646	26 - 66	6.1e-06	F-box domain
TPR_27	PF23310	88 - 195	6.2e-08	Plant tetratrico peptide repeats

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013780)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0000279.1_g000049 Rmu_sc0002045.1_g000021 Rmu_sc0005712.1_g000021
rosa_roxburghii	Rroxscaffold_1G00031850
rosa_samantha	Rh2AG354200 Rh2AG642200 Rh3AG246500 Rh3BG331600 Rh3DG304700 Rh4AG249300 Rh4BG254700 Rh5CG497500 Rh5DG239300 Rh5DG239400 Rh6CG420200 Rh7AG353600 Rh7CG371200
rosa_wichuraiana	Rw2G003200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	445
AciI	CCGC	4 cut(s)	80, 117, 681, 700
AclWI	GGATC	1 cut(s)	551
AcoI	YGGCCR	2 cut(s)	213, 850
AcsI	RAATTY	2 cut(s)	563, 790
AcuI	CTGAAG	1 cut(s)	89
AdeI	CACNNNGTG	2 cut(s)	269, 445
AfaI	GTAC	3 cut(s)	110, 377, 673
AfiI	CCNNNNNNNGG	3 cut(s)	445, 681, 859
AflIII	ACRYGT	2 cut(s)	268, 717
AgsI	TTSAA	7 cut(s)	190, 242, 482, 535, 595, 631, 713
AloI	GAACNNNNNNTCC	2 cut(s)	587, 619
AluBI	AGCT	2 cut(s)	581, 749
AluI	AGCT	2 cut(s)	581, 749
Alw26I	GTCTC	1 cut(s)	60
AlwI	GGATC	1 cut(s)	551
AoxI	GGCC	4 cut(s)	213, 447, 850, 861
ApeKI	GCWGC	1 cut(s)	785
ApoI	RAATTY	2 cut(s)	563, 790
AspS9I	GGNCC	1 cut(s)	868
AsuHPI	GGTGA	1 cut(s)	689
AvaII	GGWCC	1 cut(s)	868
BalI	TGGCCA	1 cut(s)	852
BbsI	GAAGAC	1 cut(s)	49
BbvI	GCAGC	1 cut(s)	772
BccI	CCATC	4 cut(s)	420, 498, 582, 832
BcoDI	GTCTC	1 cut(s)	60
BfaI	CTAG	1 cut(s)	140
BfmI	CTRYAG	1 cut(s)	409
BisI	GCNGC	2 cut(s)	117, 786
BlpI	GCTNAGC	1 cut(s)	282
BlsI	GCNGC	2 cut(s)	118, 787
BmcAI	AGTACT	1 cut(s)	377
Bme18I	GGWCC	1 cut(s)	868
BmgT120I	GGNCC	1 cut(s)	868
BmiI	GGNNCC	2 cut(s)	604, 743
BmsI	GCATC	4 cut(s)	213, 481, 510, 547
BpiI	GAAGAC	1 cut(s)	49
Bpu1102I	GCTNAGC	1 cut(s)	282
BsaAI	YACGTR	1 cut(s)	133
BsaJI	CCNNGG	2 cut(s)	510, 864
BsaXI	ACNNNNNCTCC	2 cut(s)	532, 562
Bsc4I	CCNNNNNNNGG	3 cut(s)	445, 681, 859
Bse3DI	GCAATG	3 cut(s)	111, 293, 875
BseDI	CCNNGG	2 cut(s)	510, 864
BseGI	GGATG	1 cut(s)	562
BseLI	CCNNNNNNNGG	3 cut(s)	445, 681, 859
BseMI	GCAATG	3 cut(s)	111, 293, 875
BseMII	CTCAG	2 cut(s)	76, 296
BseRI	GAGGAG	1 cut(s)	530
BseXI	GCAGC	1 cut(s)	772
BshFI	GGCC	4 cut(s)	215, 449, 852, 863
BsiSI	CCGG	2 cut(s)	216, 571
BslI	CCNNNNNNNGG	3 cut(s)	445, 681, 859
BsmAI	GTCTC	1 cut(s)	60
BsmBI	CGTCTC	1 cut(s)	60
BsnI	GGCC	4 cut(s)	215, 449, 852, 863
Bsp143I	GATC	1 cut(s)	543
Bsp1720I	GCTNAGC	1 cut(s)	282
Bsp19I	CCATGG	1 cut(s)	864
BspACI	CCGC	4 cut(s)	80, 117, 681, 700
BspANI	GGCC	4 cut(s)	215, 449, 852, 863
BspCNI	CTCAG	2 cut(s)	75, 295
BspLI	GGNNCC	2 cut(s)	604, 743
BspPI	GGATC	1 cut(s)	551
BsrDI	GCAATG	3 cut(s)	111, 293, 875
BssECI	CCNNGG	2 cut(s)	510, 864
BssMI	GATC	1 cut(s)	543
BssT1I	CCWWGG	1 cut(s)	864
Bst4CI	ACNGT	4 cut(s)	154, 318, 511, 599
BstBAI	YACGTR	1 cut(s)	133
BstC8I	GCNNGC	3 cut(s)	30, 391, 861
BstDEI	CTNAG	4 cut(s)	62, 282, 292, 524
BstDSI	CCRYGG	2 cut(s)	510, 864
BstF5I	GGATG	1 cut(s)	562
BstKTI	GATC	1 cut(s)	546
BstMAI	GTCTC	1 cut(s)	60
BstMBI	GATC	1 cut(s)	543
BstMWI	GCNNNNNNNGC	1 cut(s)	399
BstNSI	RCATGY	2 cut(s)	393, 721
BstSFI	CTRYAG	1 cut(s)	409
BstV1I	GCAGC	1 cut(s)	772
BstV2I	GAAGAC	1 cut(s)	49
BsuRI	GGCC	4 cut(s)	215, 449, 852, 863
BtgI	CCRYGG	2 cut(s)	510, 864
BtsCI	GGATG	1 cut(s)	562
BtsIMutI	CAGTG	4 cut(s)	70, 314, 553, 604
Cac8I	GCNNGC	3 cut(s)	30, 391, 861
Cfr13I	GGNCC	1 cut(s)	868
Csp6I	GTAC	3 cut(s)	109, 376, 672
CspCI	CAANNNNNGTGG	2 cut(s)	701, 736
CviAII	CATG	8 cut(s)	211, 340, 390, 678, 689, 718, 854, 865
CviJI	RGCY	9 cut(s)	175, 215, 435, 449, 581, 749, 785, 852, 863
CviKI_1	RGCY	9 cut(s)	175, 215, 435, 449, 581, 749, 785, 852, 863
CviQI	GTAC	3 cut(s)	109, 376, 672
DdeI	CTNAG	4 cut(s)	62, 282, 292, 524
DpnI	GATC	1 cut(s)	545
DpnII	GATC	1 cut(s)	543
DraIII	CACNNNGTG	2 cut(s)	269, 445
EaeI	YGGCCR	2 cut(s)	213, 850
Eco130I	CCWWGG	1 cut(s)	864
Eco47I	GGWCC	1 cut(s)	868
Eco57I	CTGAAG	1 cut(s)	89
EcoT14I	CCWWGG	1 cut(s)	864
ErhI	CCWWGG	1 cut(s)	864
Esp3I	CGTCTC	1 cut(s)	60
FaeI	CATG	8 cut(s)	214, 343, 393, 681, 692, 721, 857, 868
FatI	CATG	8 cut(s)	210, 339, 389, 677, 688, 717, 853, 864
FauI	CCCGC	1 cut(s)	674
Fnu4HI	GCNGC	2 cut(s)	117, 786
FokI	GGATG	1 cut(s)	569
Fsp4HI	GCNGC	2 cut(s)	117, 786
FspBI	CTAG	1 cut(s)	140
GluI	GCNGC	2 cut(s)	117, 786
HaeIII	GGCC	4 cut(s)	215, 449, 852, 863
HapII	CCGG	2 cut(s)	216, 571
Hin1II	CATG	8 cut(s)	214, 343, 393, 681, 692, 721, 857, 868
HincII	GTYRAC	1 cut(s)	730
HindII	GTYRAC	1 cut(s)	730
HinfI	GANTC	4 cut(s)	45, 311, 370, 832
HpaI	GTTAAC	1 cut(s)	730
HpaII	CCGG	2 cut(s)	216, 571
HphI	GGTGA	1 cut(s)	689
Hpy166II	GTNNAC	2 cut(s)	730, 871
Hpy188I	TCNGA	7 cut(s)	171, 231, 335, 363, 607, 831, 837
Hpy188III	TCNNGA	2 cut(s)	253, 628
Hpy8I	GTNNAC	2 cut(s)	730, 871
Hpy99I	CGWCG	1 cut(s)	42
HpyAV	CCTTC	3 cut(s)	392, 668, 719
HpyCH4III	ACNGT	4 cut(s)	154, 318, 511, 599
HpyCH4IV	ACGT	3 cut(s)	37, 132, 268
HpyCH4V	TGCA	8 cut(s)	32, 130, 204, 393, 472, 560, 768, 788
HpyF10VI	GCNNNNNNNGC	1 cut(s)	399
HpyF3I	CTNAG	4 cut(s)	62, 282, 292, 524
HpySE526I	ACGT	3 cut(s)	37, 132, 268
Hsp92II	CATG	8 cut(s)	214, 343, 393, 681, 692, 721, 857, 868
KspAI	GTTAAC	1 cut(s)	730
Kzo9I	GATC	1 cut(s)	543
LpnPI	CCDG	6 cut(s)	42, 229, 321, 336, 584, 845
Lsp1109I	GCAGC	1 cut(s)	772
LweI	GCATC	4 cut(s)	213, 481, 510, 547
MaeI	CTAG	1 cut(s)	140
MaeII	ACGT	3 cut(s)	37, 132, 268
MaeIII	GTNAC	2 cut(s)	65, 259
MalI	GATC	1 cut(s)	545
MboI	GATC	1 cut(s)	543
MboII	GAAGA	3 cut(s)	54, 95, 355
MlsI	TGGCCA	1 cut(s)	852
MluCI	AATT	7 cut(s)	18, 177, 242, 477, 535, 563, 790
MluNI	TGGCCA	1 cut(s)	852
MlyI	GAGTC	1 cut(s)	39
MnlI	CCTC	9 cut(s)	165, 258, 289, 407, 508, 534, 651, 685, 775
Mox20I	TGGCCA	1 cut(s)	852
MscI	TGGCCA	1 cut(s)	852
MseI	TTAA	3 cut(s)	380, 420, 729
MslI	CAYNNNNRTG	2 cut(s)	209, 362
Msp20I	TGGCCA	1 cut(s)	852
MspI	CCGG	2 cut(s)	216, 571
MwoI	GCNNNNNNNGC	1 cut(s)	399
NcoI	CCATGG	1 cut(s)	864
NdeII	GATC	1 cut(s)	543
NlaIII	CATG	8 cut(s)	214, 343, 393, 681, 692, 721, 857, 868
NlaIV	GGNNCC	2 cut(s)	604, 743
NmuCI	GTSAC	1 cut(s)	65
NspI	RCATGY	2 cut(s)	393, 721
PaeI	GCATGC	1 cut(s)	393
PciI	ACATGT	1 cut(s)	717
PfeI	GAWTC	3 cut(s)	311, 370, 832
PflMI	CCANNNNNTGG	1 cut(s)	445
PkrI	GCNGC	2 cut(s)	118, 787
PleI	GAGTC	1 cut(s)	39
PpsI	GAGTC	1 cut(s)	39
Ppu21I	YACGTR	1 cut(s)	133
PscI	ACATGT	1 cut(s)	717
PspN4I	GGNNCC	2 cut(s)	604, 743
PspPI	GGNCC	1 cut(s)	868
RsaI	GTAC	3 cut(s)	110, 377, 673
RsaNI	GTAC	3 cut(s)	109, 376, 672
RseI	CAYNNNNRTG	2 cut(s)	209, 362
SaqAI	TTAA	3 cut(s)	380, 420, 729
SatI	GCNGC	2 cut(s)	117, 786
Sau3AI	GATC	1 cut(s)	543
Sau96I	GGNCC	1 cut(s)	868
ScaI	AGTACT	1 cut(s)	377
SchI	GAGTC	1 cut(s)	39
SetI	ASST	7 cut(s)	40, 135, 271, 418, 583, 677, 751
SfaNI	GCATC	4 cut(s)	213, 481, 510, 547
SfcI	CTRYAG	1 cut(s)	409
SinI	GGWCC	1 cut(s)	868
SmiMI	CAYNNNNRTG	2 cut(s)	209, 362
SphI	GCATGC	1 cut(s)	393
Sse9I	AATT	7 cut(s)	18, 177, 242, 477, 535, 563, 790
SsiI	CCGC	4 cut(s)	80, 117, 681, 700
SspMI	CTAG	1 cut(s)	140
StyI	CCWWGG	1 cut(s)	864
TaaI	ACNGT	4 cut(s)	154, 318, 511, 599
TaiI	ACGT	3 cut(s)	40, 135, 271
TaqI	TCGA	5 cut(s)	40, 254, 529, 621, 780
TasI	AATT	7 cut(s)	18, 177, 242, 477, 535, 563, 790
TatI	WGTACW	2 cut(s)	108, 375
TauI	GCSGC	1 cut(s)	119
TfiI	GAWTC	3 cut(s)	311, 370, 832
Tru1I	TTAA	3 cut(s)	380, 420, 729
Tru9I	TTAA	3 cut(s)	380, 420, 729
TscAI	CASTG	4 cut(s)	70, 321, 553, 604
TseFI	GTSAC	1 cut(s)	65
TseI	GCWGC	1 cut(s)	785
Tsp45I	GTSAC	1 cut(s)	65
TspDTI	ATGAA	3 cut(s)	311, 356, 591
TspRI	CASTG	4 cut(s)	70, 321, 553, 604
Van91I	CCANNNNNTGG	1 cut(s)	445
VpaK11BI	GGWCC	1 cut(s)	868
XapI	RAATTY	2 cut(s)	563, 790
XceI	RCATGY	2 cut(s)	393, 721
XspI	CTAG	1 cut(s)	140
ZrmI	AGTACT	1 cut(s)	377

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.