Rmu_sc0000295.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000295.1
Physical Location & Seq
Forward (+)
76487 .. 79189
2703 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000295.1_g000013.1.cds

Sequence Viewer

Length: 921 bp
atgggcagttggggaagacagcaacaacagcagcggggtgatacttatcatcaacgaggttcctggactaaatttcagaacagaaagccaccgcaacatcatgatagttggcagttcaatgtgccttcctgggaaaagaagttttgtacgtcggtgggctcagttccatggaaaaagctcttagatacaaagaggtgtatgtatctttatgaaaatattgttcaatggaatgattctgcaggtgaagaggcattccaaaatgcaaaaaaccgtttttgggcaaagattaacagtcttccctgcgacatatcgttgcctgatcctgatatttatattgatgaaatagactggaactccagcattgatcctgaactgattttggacttggaaagggaacctaaaccctccgatgatgaaaccaaaggagagggtgttattgttggtcatccactccttttgaatcagtcattttcatgcactggatggggggatgctgaggatgacttcataaaagatgccagcagagatgctgaacactggggtcctggagggaatgcagataataaagaaaatccttgggaacctgtctccgatcagaataaagaagcagtaggaggatggggaagtggttggaataagtgggagaataatgataacacaagtgattggaatacccattttgatgatcctcataagaatatggattggaaaagagctgatcgagtttattggggaaatgttgatgcaaggaacagagcgaataatggtggtgcaagttggaacaactcaagaaataggacctcgagatttcagggtgattactatcagaaagatcgagggtggaggaatggaggaagaaggaatagagataatgttggttatcaacgcagtggaacttggaatgattgtcagcaagtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

306

Amino Acids

35.61

Weight (kDa)

5.45

Isoelectric Point (pI)

36.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 230
Acc36I ACCTGC 1 cut(s) 230
AciI CCGC 2 cut(s) 34, 92
AclWI GGATC 3 cut(s) 314, 359, 680
AcsI RAATTY 1 cut(s) 71
AfaI GTAC 1 cut(s) 148
AfiI CCNNNNNNNGG 1 cut(s) 277
AgsI TTSAA 3 cut(s) 118, 224, 460
AjnI CCWGG 3 cut(s) 62, 128, 544
AluBI AGCT 2 cut(s) 178, 716
AluI AGCT 2 cut(s) 178, 716
Alw26I GTCTC 1 cut(s) 592
AlwI GGATC 3 cut(s) 314, 359, 680
Ama87I CYCGRG 1 cut(s) 802
ApeKI GCWGC 1 cut(s) 31
ApoI RAATTY 1 cut(s) 71
AspS9I GGNCC 2 cut(s) 542, 798
AsuHPI GGTGA 3 cut(s) 50, 254, 827
AvaI CYCGRG 1 cut(s) 802
AvaII GGWCC 2 cut(s) 542, 798
BanII GRGCYC 1 cut(s) 161
BbsI GAAGAC 2 cut(s) 22, 287
BbvCI CCTCAGC 1 cut(s) 495
BbvI GCAGC 1 cut(s) 43
BccI CCATC 2 cut(s) 477, 612
BciT130I CCWGG 3 cut(s) 64, 130, 546
BcoDI GTCTC 1 cut(s) 592
BfmI CTRYAG 1 cut(s) 237
BfuAI ACCTGC 1 cut(s) 230
BisI GCNGC 1 cut(s) 32
BlsI GCNGC 1 cut(s) 33
Bme1390I CCNGG 3 cut(s) 64, 130, 546
Bme18I GGWCC 2 cut(s) 542, 798
BmeT110I CYCGRG 1 cut(s) 802
BmgT120I GGNCC 2 cut(s) 542, 798
BmiI GGNNCC 4 cut(s) 61, 396, 543, 582
BmrFI CCNGG 3 cut(s) 64, 130, 546
BmrI ACTGGG 1 cut(s) 547
BmsI GCATC 4 cut(s) 481, 505, 517, 733
BmuI ACTGGG 1 cut(s) 547
BpiI GAAGAC 2 cut(s) 22, 287
BpmI CTGGAG 2 cut(s) 340, 567
Bpu10I CCTNAGC 1 cut(s) 495
BpuEI CTTGAG 1 cut(s) 772
BsaBI GATNNNNATC 2 cut(s) 45, 822
BsaJI CCNNGG 3 cut(s) 129, 167, 575
BsaXI ACNNNNNCTCC 4 cut(s) 338, 368, 417, 447
Bsc4I CCNNNNNNNGG 1 cut(s) 277
Bse1I ACTGG 3 cut(s) 353, 484, 542
Bse8I GATNNNNATC 2 cut(s) 45, 822
BseBI CCWGG 3 cut(s) 64, 130, 546
BseDI CCNNGG 3 cut(s) 129, 167, 575
BseGI GGATG 5 cut(s) 445, 488, 496, 505, 623
BseJI GATNNNNATC 2 cut(s) 45, 822
BseLI CCNNNNNNNGG 1 cut(s) 277
BseMII CTCAG 2 cut(s) 174, 486
BseNI ACTGG 3 cut(s) 353, 484, 542
BseXI GCAGC 1 cut(s) 43
BsiHKCI CYCGRG 1 cut(s) 802
BslI CCNNNNNNNGG 1 cut(s) 277
BsmAI GTCTC 1 cut(s) 592
BsmI GAATGC 2 cut(s) 251, 559
BsoBI CYCGRG 1 cut(s) 802
Bsp1286I GDGCHC 1 cut(s) 161
Bsp143I GATC 6 cut(s) 319, 364, 592, 685, 718, 832
Bsp19I CCATGG 1 cut(s) 167
BspACI CCGC 2 cut(s) 34, 92
BspCNI CTCAG 2 cut(s) 173, 487
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 4 cut(s) 61, 396, 543, 582
BspMAI CTGCAG 1 cut(s) 241
BspMI ACCTGC 1 cut(s) 230
BspPI GGATC 3 cut(s) 314, 359, 680
BsrI ACTGG 3 cut(s) 353, 484, 542
BssECI CCNNGG 3 cut(s) 129, 167, 575
BssMI GATC 6 cut(s) 319, 364, 592, 685, 718, 832
BssT1I CCWWGG 2 cut(s) 167, 575
Bst2UI CCWGG 3 cut(s) 64, 130, 546
Bst4CI ACNGT 2 cut(s) 272, 293
Bst6I CTCTTC 1 cut(s) 240
BstC8I GCNNGC 1 cut(s) 520
BstDEI CTNAG 3 cut(s) 160, 181, 495
BstDSI CCRYGG 1 cut(s) 167
BstF5I GGATG 5 cut(s) 445, 488, 496, 505, 623
BstKTI GATC 6 cut(s) 322, 367, 595, 688, 721, 835
BstMAI GTCTC 1 cut(s) 592
BstMBI GATC 6 cut(s) 319, 364, 592, 685, 718, 832
BstMWI GCNNNNNNNGC 1 cut(s) 28
BstNI CCWGG 3 cut(s) 64, 130, 546
BstSCI CCNGG 3 cut(s) 62, 128, 544
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 1 cut(s) 43
BstV2I GAAGAC 2 cut(s) 22, 287
BtgI CCRYGG 1 cut(s) 167
BtsCI GGATG 5 cut(s) 445, 488, 496, 505, 623
BtsI GCAGTG 1 cut(s) 895
BtsIMutI CAGTG 3 cut(s) 477, 535, 895
BveI ACCTGC 1 cut(s) 230
Cac8I GCNNGC 1 cut(s) 520
CciI TCATGA 1 cut(s) 100
Cfr13I GGNCC 2 cut(s) 542, 798
Csp6I GTAC 1 cut(s) 147
CspCI CAANNNNNGTGG 2 cut(s) 438, 473
CviAII CATG 3 cut(s) 101, 168, 474
CviJI RGCY 4 cut(s) 88, 159, 178, 716
CviKI_1 RGCY 4 cut(s) 88, 159, 178, 716
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 3 cut(s) 160, 181, 495
DpnI GATC 6 cut(s) 321, 366, 594, 687, 720, 834
DpnII GATC 6 cut(s) 319, 364, 592, 685, 718, 832
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
Eco130I CCWWGG 2 cut(s) 167, 575
Eco24I GRGCYC 1 cut(s) 161
Eco47I GGWCC 2 cut(s) 542, 798
Eco88I CYCGRG 1 cut(s) 802
EcoO109I RGGNCCY 2 cut(s) 542, 798
EcoRII CCWGG 3 cut(s) 62, 128, 544
EcoT14I CCWWGG 2 cut(s) 167, 575
EcoT38I GRGCYC 1 cut(s) 161
ErhI CCWWGG 2 cut(s) 167, 575
FaeI CATG 3 cut(s) 104, 171, 477
FatI CATG 3 cut(s) 100, 167, 473
FauI CCCGC 1 cut(s) 27
Fnu4HI GCNGC 1 cut(s) 32
FokI GGATG 5 cut(s) 432, 495, 503, 512, 630
FriOI GRGCYC 1 cut(s) 161
Fsp4HI GCNGC 1 cut(s) 32
GluI GCNGC 1 cut(s) 32
GsuI CTGGAG 2 cut(s) 340, 567
Hin1II CATG 3 cut(s) 104, 171, 477
HinfI GANTC 2 cut(s) 233, 460
HphI GGTGA 3 cut(s) 50, 254, 827
Hpy188I TCNGA 6 cut(s) 78, 409, 592, 597, 828, 920
Hpy188III TCNNGA 5 cut(s) 101, 323, 368, 789, 804
Hpy99I CGWCG 1 cut(s) 154
HpyAV CCTTC 2 cut(s) 135, 852
HpyCH4III ACNGT 2 cut(s) 272, 293
HpyCH4IV ACGT 1 cut(s) 149
HpyCH4V TGCA 6 cut(s) 239, 263, 477, 557, 746, 773
HpyF10VI GCNNNNNNNGC 1 cut(s) 28
HpyF3I CTNAG 3 cut(s) 160, 181, 495
HpySE526I ACGT 1 cut(s) 149
Hsp92II CATG 3 cut(s) 104, 171, 477
Kzo9I GATC 6 cut(s) 319, 364, 592, 685, 718, 832
Lsp1109I GCAGC 1 cut(s) 43
LweI GCATC 4 cut(s) 481, 505, 517, 733
MaeII ACGT 1 cut(s) 149
MalI GATC 6 cut(s) 321, 366, 594, 687, 720, 834
MboI GATC 6 cut(s) 319, 364, 592, 685, 718, 832
MboII GAAGA 4 cut(s) 27, 257, 287, 867
MhlI GDGCHC 1 cut(s) 161
MluCI AATT 1 cut(s) 71
MmeI TCCRAC 2 cut(s) 611, 758
MseI TTAA 1 cut(s) 288
MslI CAYNNNNRTG 2 cut(s) 472, 681
MspA1I CMGCKG 1 cut(s) 34
MspR9I CCNGG 3 cut(s) 64, 130, 546
Mva1269I GAATGC 2 cut(s) 251, 559
MvaI CCWGG 3 cut(s) 64, 130, 546
MwoI GCNNNNNNNGC 1 cut(s) 28
NcoI CCATGG 1 cut(s) 167
NdeII GATC 6 cut(s) 319, 364, 592, 685, 718, 832
NlaIII CATG 3 cut(s) 104, 171, 477
NlaIV GGNNCC 4 cut(s) 61, 396, 543, 582
PaeR7I CTCGAG 1 cut(s) 802
PagI TCATGA 1 cut(s) 100
PaqCI CACCTGC 1 cut(s) 230
PctI GAATGC 2 cut(s) 251, 559
PfeI GAWTC 2 cut(s) 233, 460
PfoI TCCNGGA 2 cut(s) 62, 544
PkrI GCNGC 1 cut(s) 33
PpuMI RGGWCCY 2 cut(s) 542, 798
Psp5II RGGWCCY 2 cut(s) 542, 798
Psp6I CCWGG 3 cut(s) 62, 128, 544
PspGI CCWGG 3 cut(s) 62, 128, 544
PspN4I GGNNCC 4 cut(s) 61, 396, 543, 582
PspPI GGNCC 2 cut(s) 542, 798
PspPPI RGGWCCY 2 cut(s) 542, 798
PstI CTGCAG 1 cut(s) 241
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
RseI CAYNNNNRTG 2 cut(s) 472, 681
SaqAI TTAA 1 cut(s) 288
SatI GCNGC 1 cut(s) 32
Sau3AI GATC 6 cut(s) 319, 364, 592, 685, 718, 832
Sau96I GGNCC 2 cut(s) 542, 798
ScrFI CCNGG 3 cut(s) 64, 130, 546
SduI GDGCHC 1 cut(s) 161
SetI ASST 9 cut(s) 61, 152, 180, 197, 244, 400, 586, 718, 803
SfaNI GCATC 4 cut(s) 481, 505, 517, 733
SfcI CTRYAG 1 cut(s) 237
Sfr274I CTCGAG 1 cut(s) 802
SinI GGWCC 2 cut(s) 542, 798
SlaI CTCGAG 1 cut(s) 802
SmiMI CAYNNNNRTG 2 cut(s) 472, 681
SmlI CTYRAG 2 cut(s) 787, 802
SmoI CTYRAG 2 cut(s) 787, 802
Sse9I AATT 1 cut(s) 71
SsiI CCGC 2 cut(s) 34, 92
SspI AATATT 1 cut(s) 217
StyD4I CCNGG 3 cut(s) 62, 128, 544
StyI CCWWGG 2 cut(s) 167, 575
TaaI ACNGT 2 cut(s) 272, 293
TaiI ACGT 1 cut(s) 152
TaqI TCGA 3 cut(s) 721, 803, 835
TasI AATT 1 cut(s) 71
TfiI GAWTC 2 cut(s) 233, 460
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 3 cut(s) 484, 542, 895
TseI GCWGC 1 cut(s) 31
TspDTI ATGAA 5 cut(s) 225, 354, 429, 462, 496
TspRI CASTG 3 cut(s) 484, 542, 895
VpaK11BI GGWCC 2 cut(s) 542, 798
XapI RAATTY 1 cut(s) 71
XhoI CTCGAG 1 cut(s) 802
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.