Rmu_sc0000312.1_g000001

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000312.1
OG0014950
Physical Location & Seq
Forward (+)
1124 .. 3941
2818 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000312.1_g000001.1.cds

Sequence Viewer

Length: 1110 bp
atgcttctgagtcctagcacttgttcaaaaccatgttcttttccggccatattcaactttggagactcaaactcagacaccgggggcctgtccgcagcgtttggacaagctccttatcccaatggagagacattttttggaacaccttcgggacgttattccgatggccgtcttataattgatttcatagctgaaagcttgagattacctcatctgagtgcatttttggactcggttggatcaaacttcagccacggagcgaattttgcaactgcaggatcaaccatcagacccccaaacatgaccatccaatatggacctagtcccatttccttagatgtgcagtatgtcgaattctcaaacttccacacgagatcgcaaatttatcgcaaaaaaggagagttatttgagaaactgcttcccagagtagagtacttttctcaagcactttatacctttgacattggccaaaatgatctcactgctggttacaagcttaacatgaccatagaacaaataaaggcctatgttccagatgtgctaggccagttctctaatgtcatcaaggatatatataatgaagggggaagaacattttggatccacaacacaggaccagtgggctgctacccctatattctggataggttctttgtcaacccagcccaatataataagtatgggtgtgcaagtccgtttaatgatgtggcccaatttttcaaccaaagattaaagaaagctgtggttcagcttgagcaagatcttcccatggctgcattcacctatgtggatatctactcactaaagtacaccctcattactcaagccaagaaatatggatttgagaagccactcgtagcatgttgtggtcgtggtgggaaatacaattacaacctacatgagaagtgtggggcgaagaagactatcaacggcaaagaggtagtaatcgctaactcgtgcaaggatccaatgactaggattaattgggacgggacgcatttcactgaggctgccaacaaatggatatttcaacaaattttgaatggctccttttcagatccaccaaacccgttggaaatggcttgtcaaagaaggaaaacaaagaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0016298 GO:0016787 GO:0016788
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

369

Amino Acids

41.37

Weight (kDa)

8.79

Isoelectric Point (pI)

26.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014950)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26430
fragaria_vesca FvH4_4g26020
malus_domestica MD16G1100400.v1.1
prunus_persica Prupe.1G246600_v2.0.a1 Prupe.1G246600_v2.0.a1
pyrus_communis pycom16g08510
rosa_chinensis RchiOBHm_Chr4g0433461
rosa_laevigata RLG00000006751
rosa_multiflora Rmu_sc0000312.1_g000001
rosa_roxburghii Rroxscaffold_5G00375000
rosa_rugosa Rorug04G0269000
rosa_samantha Rh4BG331600 Rh4CG346900 Rh4DG327900
rosa_wichuraiana Rw0G020090 Rw4G028040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 176
AccB7I CCANNNNNTGG 1 cut(s) 1020
AciI CCGC 1 cut(s) 93
AclWI GGATC 7 cut(s) 247, 286, 595, 608, 959, 972, 1052
AcoI YGGCCR 3 cut(s) 45, 166, 466
AcsI RAATTY 4 cut(s) 262, 353, 381, 1035
AcuI CTGAAG 1 cut(s) 232
AfaI GTAC 2 cut(s) 434, 809
AfiI CCNNNNNNNGG 1 cut(s) 1020
AgsI TTSAA 5 cut(s) 27, 55, 721, 1031, 1042
AjuI GAANNNNNNNTTGG 2 cut(s) 580, 612
AleI CACNNNNGTG 1 cut(s) 785
AluBI AGCT 6 cut(s) 110, 191, 198, 496, 740, 751
AluI AGCT 6 cut(s) 110, 191, 198, 496, 740, 751
Alw26I GTCTC 2 cut(s) 57, 122
AlwI GGATC 7 cut(s) 247, 286, 595, 608, 959, 972, 1052
AoxI GGCC 7 cut(s) 45, 85, 166, 466, 522, 544, 708
ApeKI GCWGC 4 cut(s) 95, 624, 773, 1010
ApoI RAATTY 4 cut(s) 262, 353, 381, 1035
AseI ATTAAT 1 cut(s) 981
Asp700I GAANNNNTTC 1 cut(s) 145
AspS9I GGNCC 4 cut(s) 85, 317, 614, 709
AsuC2I CCSGG 1 cut(s) 82
AsuHPI GGTGA 1 cut(s) 772
AvaII GGWCC 2 cut(s) 317, 614
BalI TGGCCA 1 cut(s) 468
BamHI GGATCC 2 cut(s) 600, 964
BauI CACGAG 2 cut(s) 370, 955
BbsI GAAGAC 1 cut(s) 926
BbvI GCAGC 4 cut(s) 107, 611, 760, 997
BccI CCATC 3 cut(s) 158, 293, 314
BceAI ACGGC 2 cut(s) 153, 946
BcgI CGANNNNNNTGC 2 cut(s) 368, 402
BcnI CCSGG 1 cut(s) 82
BcoDI GTCTC 2 cut(s) 57, 122
BfaI CTAG 4 cut(s) 15, 321, 542, 975
BfmI CTRYAG 1 cut(s) 273
BglII AGATCT 1 cut(s) 760
BisI GCNGC 4 cut(s) 96, 625, 774, 1011
BlsI GCNGC 4 cut(s) 97, 626, 775, 1012
BmcAI AGTACT 1 cut(s) 434
Bme1390I CCNGG 1 cut(s) 82
Bme18I GGWCC 2 cut(s) 317, 614
BmgT120I GGNCC 4 cut(s) 85, 317, 614, 709
BmiI GGNNCC 4 cut(s) 86, 602, 966, 1048
BmrFI CCNGG 1 cut(s) 82
BpiI GAAGAC 1 cut(s) 926
BplI GAGNNNNNCTC 2 cut(s) 193, 225
BpuEI CTTGAG 4 cut(s) 220, 426, 773, 807
BpuMI CCSGG 1 cut(s) 82
BsaJI CCNNGG 3 cut(s) 81, 253, 768
Bsc4I CCNNNNNNNGG 1 cut(s) 1020
Bse1I ACTGG 2 cut(s) 547, 617
BseDI CCNNGG 3 cut(s) 81, 253, 768
BseGI GGATG 1 cut(s) 306
BseLI CCNNNNNNNGG 1 cut(s) 1020
BseMII CTCAG 3 cut(s) 87, 206, 996
BseNI ACTGG 2 cut(s) 547, 617
BseXI GCAGC 4 cut(s) 107, 611, 760, 997
BseYI CCCAGC 1 cut(s) 661
BsgI GTGCAG 1 cut(s) 362
BshFI GGCC 7 cut(s) 47, 87, 168, 468, 524, 546, 710
BsiSI CCGG 2 cut(s) 44, 81
BslFI GGGAC 4 cut(s) 165, 309, 1001, 1006
BslI CCNNNNNNNGG 1 cut(s) 1020
BsmAI GTCTC 2 cut(s) 57, 122
BsmFI GGGAC 4 cut(s) 165, 309, 1001, 1006
BsmI GAATGC 1 cut(s) 776
BsnI GGCC 7 cut(s) 47, 87, 168, 468, 524, 546, 710
Bsp143I GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
Bsp19I CCATGG 1 cut(s) 768
BspACI CCGC 1 cut(s) 93
BspANI GGCC 7 cut(s) 47, 87, 168, 468, 524, 546, 710
BspCNI CTCAG 3 cut(s) 86, 207, 997
BspLI GGNNCC 4 cut(s) 86, 602, 966, 1048
BspMAI CTGCAG 1 cut(s) 277
BspPI GGATC 7 cut(s) 247, 286, 595, 608, 959, 972, 1052
BsrI ACTGG 2 cut(s) 547, 617
BssECI CCNNGG 3 cut(s) 81, 253, 768
BssMI GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
BssSI CACGAG 2 cut(s) 370, 955
BssT1I CCWWGG 1 cut(s) 768
Bst2BI CACGAG 2 cut(s) 370, 955
BstDEI CTNAG 5 cut(s) 8, 73, 215, 334, 1005
BstDSI CCRYGG 2 cut(s) 253, 768
BstF5I GGATG 1 cut(s) 306
BstKTI GATC 8 cut(s) 242, 281, 377, 478, 603, 763, 967, 1060
BstMAI GTCTC 2 cut(s) 57, 122
BstMBI GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
BstMWI GCNNNNNNNGC 1 cut(s) 266
BstNSI RCATGY 1 cut(s) 864
BstSCI CCNGG 1 cut(s) 80
BstSFI CTRYAG 1 cut(s) 273
BstV1I GCAGC 4 cut(s) 107, 611, 760, 997
BstV2I GAAGAC 1 cut(s) 926
BstX2I RGATCY 4 cut(s) 600, 760, 964, 1057
BstYI RGATCY 4 cut(s) 600, 760, 964, 1057
BsuRI GGCC 7 cut(s) 47, 87, 168, 468, 524, 546, 710
BtgI CCRYGG 2 cut(s) 253, 768
BtsCI GGATG 1 cut(s) 306
BtsI GCAGTG 1 cut(s) 480
BtsIMutI CAGTG 3 cut(s) 480, 624, 1002
Cfr13I GGNCC 4 cut(s) 85, 317, 614, 709
CseI GACGC 1 cut(s) 1003
Csp6I GTAC 2 cut(s) 433, 808
CviAII CATG 6 cut(s) 33, 301, 502, 769, 861, 899
CviQI GTAC 2 cut(s) 433, 808
DdeI CTNAG 5 cut(s) 8, 73, 215, 334, 1005
DpnI GATC 8 cut(s) 241, 280, 376, 477, 602, 762, 966, 1059
DpnII GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
EaeI YGGCCR 3 cut(s) 45, 166, 466
Eco130I CCWWGG 1 cut(s) 768
Eco147I AGGCCT 1 cut(s) 524
Eco32I GATATC 1 cut(s) 793
Eco47I GGWCC 2 cut(s) 317, 614
Eco57I CTGAAG 1 cut(s) 232
EcoO109I RGGNCCY 1 cut(s) 85
EcoRI GAATTC 1 cut(s) 353
EcoRV GATATC 1 cut(s) 793
EcoT14I CCWWGG 1 cut(s) 768
ErhI CCWWGG 1 cut(s) 768
FaeI CATG 6 cut(s) 36, 304, 505, 772, 864, 902
FaqI GGGAC 4 cut(s) 165, 309, 1001, 1006
FatI CATG 6 cut(s) 32, 300, 501, 768, 860, 898
Fnu4HI GCNGC 4 cut(s) 96, 625, 774, 1011
FokI GGATG 1 cut(s) 293
Fsp4HI GCNGC 4 cut(s) 96, 625, 774, 1011
FspBI CTAG 4 cut(s) 15, 321, 542, 975
GluI GCNGC 4 cut(s) 96, 625, 774, 1011
GsaI CCCAGC 1 cut(s) 665
HaeIII GGCC 7 cut(s) 47, 87, 168, 468, 524, 546, 710
HapII CCGG 2 cut(s) 44, 81
HgaI GACGC 1 cut(s) 1003
Hin1II CATG 6 cut(s) 36, 304, 505, 772, 864, 902
HincII GTYRAC 1 cut(s) 658
HindII GTYRAC 1 cut(s) 658
HindIII AAGCTT 2 cut(s) 196, 494
HinfI GANTC 3 cut(s) 10, 65, 230
HpaII CCGG 2 cut(s) 44, 81
HphI GGTGA 1 cut(s) 772
Hpy166II GTNNAC 2 cut(s) 658, 810
Hpy188I TCNGA 6 cut(s) 9, 76, 163, 216, 290, 1057
Hpy188III TCNNGA 3 cut(s) 150, 533, 641
Hpy8I GTNNAC 2 cut(s) 658, 810
HpyAV CCTTC 3 cut(s) 156, 575, 1086
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 7 cut(s) 221, 269, 275, 343, 689, 776, 960
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 5 cut(s) 8, 73, 215, 334, 1005
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 6 cut(s) 36, 304, 505, 772, 864, 902
Kzo9I GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
LmnI GCTCC 3 cut(s) 115, 257, 1052
Lsp1109I GCAGC 4 cut(s) 107, 611, 760, 997
MaeI CTAG 4 cut(s) 15, 321, 542, 975
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 488
MalI GATC 8 cut(s) 241, 280, 376, 477, 602, 762, 966, 1059
MboI GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
MboII GAAGA 4 cut(s) 600, 755, 928, 931
MflI RGATCY 4 cut(s) 600, 760, 964, 1057
MlsI TGGCCA 1 cut(s) 468
MluCI AATT 8 cut(s) 177, 262, 353, 381, 713, 886, 982, 1035
MluNI TGGCCA 1 cut(s) 468
MlyI GAGTC 3 cut(s) 19, 59, 224
MmeI TCCRAC 2 cut(s) 217, 1053
MnlI CCTC 4 cut(s) 219, 824, 931, 1000
Mox20I TGGCCA 1 cut(s) 468
MroXI GAANNNNTTC 1 cut(s) 145
MscI TGGCCA 1 cut(s) 468
MseI TTAA 4 cut(s) 498, 699, 731, 981
MslI CAYNNNNRTG 2 cut(s) 216, 785
Msp20I TGGCCA 1 cut(s) 468
MspI CCGG 2 cut(s) 44, 81
MspR9I CCNGG 1 cut(s) 82
Mva1269I GAATGC 1 cut(s) 776
MwoI GCNNNNNNNGC 1 cut(s) 266
NciI CCSGG 1 cut(s) 82
NcoI CCATGG 1 cut(s) 768
NdeII GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
NlaIII CATG 6 cut(s) 36, 304, 505, 772, 864, 902
NlaIV GGNNCC 4 cut(s) 86, 602, 966, 1048
NspI RCATGY 1 cut(s) 864
OliI CACNNNNGTG 1 cut(s) 785
PceI AGGCCT 1 cut(s) 524
PctI GAATGC 1 cut(s) 776
PdmI GAANNNNTTC 1 cut(s) 145
PflFI GACNNNGTC 1 cut(s) 321
PflMI CCANNNNNTGG 1 cut(s) 1020
PkrI GCNGC 4 cut(s) 97, 626, 775, 1012
PleI GAGTC 3 cut(s) 18, 59, 224
PpsI GAGTC 3 cut(s) 18, 59, 224
PshBI ATTAAT 1 cut(s) 981
PsiI TTATAA 1 cut(s) 176
PspFI CCCAGC 1 cut(s) 661
PspN4I GGNNCC 4 cut(s) 86, 602, 966, 1048
PspPI GGNCC 4 cut(s) 85, 317, 614, 709
PstI CTGCAG 1 cut(s) 277
PsuI RGATCY 4 cut(s) 600, 760, 964, 1057
PsyI GACNNNGTC 1 cut(s) 321
RsaI GTAC 2 cut(s) 434, 809
RsaNI GTAC 2 cut(s) 433, 808
RseI CAYNNNNRTG 2 cut(s) 216, 785
SaqAI TTAA 4 cut(s) 498, 699, 731, 981
SatI GCNGC 4 cut(s) 96, 625, 774, 1011
Sau3AI GATC 8 cut(s) 239, 278, 374, 475, 600, 760, 964, 1057
Sau96I GGNCC 4 cut(s) 85, 317, 614, 709
ScaI AGTACT 1 cut(s) 434
SchI GAGTC 3 cut(s) 19, 59, 224
ScrFI CCNGG 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 273
SinI GGWCC 2 cut(s) 317, 614
SmiMI CAYNNNNRTG 2 cut(s) 216, 785
SmlI CTYRAG 4 cut(s) 199, 441, 752, 822
SmoI CTYRAG 4 cut(s) 199, 441, 752, 822
Sse9I AATT 8 cut(s) 177, 262, 353, 381, 713, 886, 982, 1035
SseBI AGGCCT 1 cut(s) 524
SsiI CCGC 1 cut(s) 93
SspMI CTAG 4 cut(s) 15, 321, 542, 975
StuI AGGCCT 1 cut(s) 524
StyD4I CCNGG 1 cut(s) 80
StyI CCWWGG 1 cut(s) 768
TaiI ACGT 1 cut(s) 157
TaqI TCGA 1 cut(s) 351
TasI AATT 8 cut(s) 177, 262, 353, 381, 713, 886, 982, 1035
TatI WGTACW 2 cut(s) 432, 807
Tru1I TTAA 4 cut(s) 498, 699, 731, 981
Tru9I TTAA 4 cut(s) 498, 699, 731, 981
TscAI CASTG 3 cut(s) 487, 624, 1009
TseI GCWGC 4 cut(s) 95, 624, 773, 1010
TspDTI ATGAA 2 cut(s) 175, 594
TspGWI ACGGA 2 cut(s) 270, 684
TspRI CASTG 3 cut(s) 487, 624, 1009
Tth111I GACNNNGTC 1 cut(s) 321
Van91I CCANNNNNTGG 1 cut(s) 1020
VpaK11BI GGWCC 2 cut(s) 317, 614
VspI ATTAAT 1 cut(s) 981
XapI RAATTY 4 cut(s) 262, 353, 381, 1035
XceI RCATGY 1 cut(s) 864
XmnI GAANNNNTTC 1 cut(s) 145
XspI CTAG 4 cut(s) 15, 321, 542, 975
ZrmI AGTACT 1 cut(s) 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.