Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000322.1

Orthogroup ID

OG0010480

Physical Location & Seq

Genomic Coordinates Forward (+)

155677 .. 157187

Gene Structure 1511 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000322.1_g000039.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 870 bp

atggcaccgggactgagttcgaagaggagagagcgacagagctttcatggcagagagagagagggagagagaaaccggagggcaaggacccaaggggatcggaaaccttcttcgccggtaaggtcgctctggaccgccgaggaggtcgatctcgaccatcactcacatcctccccttcttcgttggcgaaatttgaagatccgtttcgaacttctgctaggacttctgcacgatctcactgttgacttcgtttccgacgaccggcgaccaggccgacggggatgtggccagatcgcgtttcggcacgatccttatattgggaagctgtttctggaggaatatgatcacaaagggatgagggagtcgagaaagagtgccgtgttgagagccaaagaggcctccaattggggcattgtgcttgggactttaggaaggcaagggaatccgaggattctacagagattggagaagaagatgagggagaaggggtttgattatactgtggtgttaatgtcggagattagtccggcgagaattgctttgtttgaggactctgtggatgcttggatacagattgcttgtcctcgcttgtcaattgattggggggatgcatttacgaagccccttttgaatcctttcgagactgacattgctcttggcttcatacctggttggtgggagaggaataagaaaagtgattcggggtgctgtgcttgtggtaatggcaatgggactgctgaagaccttgtaggggactatcccatggattactatgctgcggatggaggggagtggaactcctcttatgtcaacaagctgacacgccctgtttgcagggattccgcattggcaactgccaacattgaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006417 GO:0006448 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009889 GO:0009987 GO:0010468 GO:0010556 GO:0010608 GO:0017182 GO:0017183 GO:0018193 GO:0018202 GO:0019222 GO:0019538 GO:0031323 GO:0031326 GO:0032268 GO:0034248 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0050789 GO:0050794 GO:0051171 GO:0051246 GO:0060255 GO:0065007 GO:0071704 GO:0080090 GO:1900247 GO:1901564 GO:2000112 GO:2000765

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Diphthamide_syn

Protein Analysis

289

Amino Acids

32.9

Weight (kDa)

8.7

Isoelectric Point (pI)

52.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010480)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G62030
fragaria_vesca	FvH4_5g30480 FvH4_5g30480
malus_domestica	MD04G1037900.v1.1
prunus_persica	Prupe.1G561000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0225101 RchiOBHm_Chr7g0225141
rosa_laevigata	RLG00000001844
rosa_multiflora	Rmu_co8105986.1_g000001 Rmu_sc0000307.1_g000014 Rmu_sc0000322.1_g000032 Rmu_sc0000322.1_g000039
rosa_roxburghii	Rroxscaffold_3G00234210
rosa_rugosa	Rorug07G0227600 Rorug07G0227700
rosa_samantha	Rh7AG376200 Rh7BG362500 Rh7CG394900 Rh7DG372600 Rh7DG373000
rosa_wichuraiana	Rw7G031440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	4
AccII	CGCG	1 cut(s)	296
AciI	CCGC	3 cut(s)	135, 779, 843
AclWI	GGATC	3 cut(s)	105, 193, 302
AcoI	YGGCCR	1 cut(s)	286
AcsI	RAATTY	1 cut(s)	190
AcuI	CTGAAG	1 cut(s)	759
AfiI	CCNNNNNNNGG	4 cut(s)	261, 317, 405, 751
AgsI	TTSAA	3 cut(s)	196, 631, 866
AjnI	CCWGG	2 cut(s)	268, 667
AluBI	AGCT	3 cut(s)	42, 325, 817
AluI	AGCT	3 cut(s)	42, 325, 817
Alw26I	GTCTC	1 cut(s)	635
AlwI	GGATC	3 cut(s)	105, 193, 302
AoxI	GGCC	3 cut(s)	271, 286, 396
ApeKI	GCWGC	1 cut(s)	776
ApoI	RAATTY	1 cut(s)	190
Asp700I	GAANNNNTTC	1 cut(s)	635
AspS9I	GGNCC	2 cut(s)	87, 132
AsuC2I	CCSGG	1 cut(s)	9
AsuII	TTCGAA	2 cut(s)	20, 207
AvaII	GGWCC	2 cut(s)	87, 132
BalI	TGGCCA	1 cut(s)	288
BanI	GGYRCC	1 cut(s)	4
BbsI	GAAGAC	1 cut(s)	747
BbvI	GCAGC	1 cut(s)	763
BccI	CCATC	2 cut(s)	165, 776
BceAI	ACGGC	1 cut(s)	362
BciT130I	CCWGG	2 cut(s)	270, 669
BciVI	GTATCC	1 cut(s)	561
BclI	TGATCA	1 cut(s)	343
BcnI	CCSGG	1 cut(s)	9
BcoDI	GTCTC	1 cut(s)	635
BfaI	CTAG	1 cut(s)	218
BfmI	CTRYAG	1 cut(s)	455
BfuI	GTATCC	1 cut(s)	561
BglI	GCCNNNNNGGC	1 cut(s)	395
BisI	GCNGC	1 cut(s)	777
BlsI	GCNGC	1 cut(s)	778
Bme1390I	CCNGG	3 cut(s)	9, 270, 669
Bme18I	GGWCC	2 cut(s)	87, 132
BmgT120I	GGNCC	2 cut(s)	87, 132
BmiI	GGNNCC	2 cut(s)	6, 89
BmrFI	CCNGG	3 cut(s)	9, 270, 669
BmsI	GCATC	2 cut(s)	550, 598
BpiI	GAAGAC	1 cut(s)	747
BplI	GAGNNNNNCTC	2 cut(s)	782, 814
BpmI	CTGGAG	1 cut(s)	353
Bpu14I	TTCGAA	2 cut(s)	20, 207
BpuMI	CCSGG	1 cut(s)	9
BsaJI	CCNNGG	4 cut(s)	91, 138, 446, 762
BsaWI	WCCGGW	1 cut(s)	75
BsaXI	ACNNNNNCTCC	2 cut(s)	473, 503
Bsc4I	CCNNNNNNNGG	4 cut(s)	261, 317, 405, 751
Bse118I	RCCGGY	2 cut(s)	115, 261
Bse3DI	GCAATG	2 cut(s)	648, 733
BseBI	CCWGG	2 cut(s)	270, 669
BseDI	CCNNGG	4 cut(s)	91, 138, 446, 762
BseGI	GGATG	6 cut(s)	166, 287, 360, 565, 613, 787
BseLI	CCNNNNNNNGG	4 cut(s)	261, 317, 405, 751
BseMI	GCAATG	2 cut(s)	648, 733
BseMII	CTCAG	1 cut(s)	5
BseRI	GAGGAG	3 cut(s)	40, 155, 790
BseXI	GCAGC	1 cut(s)	763
BsgI	GTGCAG	1 cut(s)	212
Bsh1236I	CGCG	1 cut(s)	296
Bsh1285I	CGRYCG	1 cut(s)	262
BshFI	GGCC	3 cut(s)	273, 288, 398
BshNI	GGYRCC	1 cut(s)	4
BsiEI	CGRYCG	1 cut(s)	262
BsiSI	CCGG	5 cut(s)	8, 76, 116, 262, 527
BslFI	GGGAC	4 cut(s)	24, 436, 745, 767
BslI	CCNNNNNNNGG	4 cut(s)	261, 317, 405, 751
BsmAI	GTCTC	1 cut(s)	635
BsmFI	GGGAC	4 cut(s)	24, 436, 745, 767
BsnI	GGCC	3 cut(s)	273, 288, 398
Bsp119I	TTCGAA	2 cut(s)	20, 207
Bsp143I	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
Bsp19I	CCATGG	1 cut(s)	762
BspACI	CCGC	3 cut(s)	135, 779, 843
BspANI	GGCC	3 cut(s)	273, 288, 398
BspCNI	CTCAG	1 cut(s)	6
BspFNI	CGCG	1 cut(s)	296
BspLI	GGNNCC	2 cut(s)	6, 89
BspPI	GGATC	3 cut(s)	105, 193, 302
BspT104I	TTCGAA	2 cut(s)	20, 207
BspT107I	GGYRCC	1 cut(s)	4
BsrDI	GCAATG	2 cut(s)	648, 733
BsrFI	RCCGGY	2 cut(s)	115, 261
BssAI	RCCGGY	2 cut(s)	115, 261
BssECI	CCNNGG	4 cut(s)	91, 138, 446, 762
BssMI	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
BssT1I	CCWWGG	2 cut(s)	91, 762
Bst2UI	CCWGG	2 cut(s)	270, 669
Bst4CI	ACNGT	2 cut(s)	241, 502
Bst6I	CTCTTC	1 cut(s)	17
BstBI	TTCGAA	2 cut(s)	20, 207
BstDEI	CTNAG	1 cut(s)	14
BstDSI	CCRYGG	1 cut(s)	762
BstF5I	GGATG	6 cut(s)	166, 287, 360, 565, 613, 787
BstFNI	CGCG	1 cut(s)	296
BstKTI	GATC	7 cut(s)	100, 151, 201, 235, 294, 310, 346
BstMAI	GTCTC	1 cut(s)	635
BstMBI	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
BstMCI	CGRYCG	1 cut(s)	262
BstMWI	GCNNNNNNNGC	4 cut(s)	48, 395, 536, 831
BstNI	CCWGG	2 cut(s)	270, 669
BstSCI	CCNGG	3 cut(s)	7, 268, 667
BstSFI	CTRYAG	1 cut(s)	455
BstUI	CGCG	1 cut(s)	296
BstV1I	GCAGC	1 cut(s)	763
BstV2I	GAAGAC	1 cut(s)	747
BstX2I	RGATCY	1 cut(s)	198
BstYI	RGATCY	1 cut(s)	198
BsuI	GTATCC	1 cut(s)	561
BsuRI	GGCC	3 cut(s)	273, 288, 398
BtgI	CCRYGG	1 cut(s)	762
BtsCI	GGATG	6 cut(s)	166, 287, 360, 565, 613, 787
BtsIMutI	CAGTG	1 cut(s)	237
Cfr10I	RCCGGY	2 cut(s)	115, 261
Cfr13I	GGNCC	2 cut(s)	87, 132
CsiI	ACCWGGT	1 cut(s)	667
CviAII	CATG	2 cut(s)	47, 763
CviJI	RGCY	9 cut(s)	42, 273, 288, 325, 389, 398, 622, 660, 817
CviKI_1	RGCY	9 cut(s)	42, 273, 288, 325, 389, 398, 622, 660, 817
DdeI	CTNAG	1 cut(s)	14
DpnI	GATC	7 cut(s)	99, 150, 200, 234, 293, 309, 345
DpnII	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
EaeI	YGGCCR	1 cut(s)	286
Eam1104I	CTCTTC	1 cut(s)	17
EarI	CTCTTC	1 cut(s)	17
Eco130I	CCWWGG	2 cut(s)	91, 762
Eco147I	AGGCCT	1 cut(s)	398
Eco47I	GGWCC	2 cut(s)	87, 132
Eco57I	CTGAAG	1 cut(s)	759
EcoO109I	RGGNCCY	1 cut(s)	87
EcoRII	CCWGG	2 cut(s)	268, 667
EcoT14I	CCWWGG	2 cut(s)	91, 762
EcoT22I	ATGCAT	1 cut(s)	613
ErhI	CCWWGG	2 cut(s)	91, 762
FaeI	CATG	2 cut(s)	50, 766
FaiI	YATR	8 cut(s)	48, 315, 342, 498, 665, 764, 774, 807
FaqI	GGGAC	4 cut(s)	24, 436, 745, 767
FatI	CATG	2 cut(s)	46, 762
FbaI	TGATCA	1 cut(s)	343
Fnu4HI	GCNGC	1 cut(s)	777
FokI	GGATG	6 cut(s)	153, 294, 367, 572, 620, 794
Fsp4HI	GCNGC	1 cut(s)	777
FspBI	CTAG	1 cut(s)	218
GluI	GCNGC	1 cut(s)	777
GsuI	CTGGAG	1 cut(s)	353
HaeIII	GGCC	3 cut(s)	273, 288, 398
HapII	CCGG	5 cut(s)	8, 76, 116, 262, 527
Hin1II	CATG	2 cut(s)	50, 766
HincII	GTYRAC	2 cut(s)	244, 811
HindII	GTYRAC	2 cut(s)	244, 811
HinfI	GANTC	7 cut(s)	362, 442, 451, 551, 631, 698, 839
HpaII	CCGG	5 cut(s)	8, 76, 116, 262, 527
Hpy166II	GTNNAC	2 cut(s)	244, 811
Hpy188I	TCNGA	4 cut(s)	102, 256, 447, 517
Hpy188III	TCNNGA	5 cut(s)	130, 152, 332, 366, 640
Hpy8I	GTNNAC	2 cut(s)	244, 811
Hpy99I	CGWCG	2 cut(s)	260, 279
HpyAV	CCTTC	4 cut(s)	117, 185, 426, 478
HpyCH4III	ACNGT	2 cut(s)	241, 502
HpyCH4V	TGCA	3 cut(s)	229, 611, 834
HpyF10VI	GCNNNNNNNGC	4 cut(s)	48, 395, 536, 831
HpyF3I	CTNAG	1 cut(s)	14
Hsp92II	CATG	2 cut(s)	50, 766
Ksp22I	TGATCA	1 cut(s)	343
Kzo9I	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
Lsp1109I	GCAGC	1 cut(s)	763
LweI	GCATC	2 cut(s)	550, 598
MabI	ACCWGGT	1 cut(s)	667
MaeI	CTAG	1 cut(s)	218
MalI	GATC	7 cut(s)	99, 150, 200, 234, 293, 309, 345
MboI	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
MboII	GAAGA	7 cut(s)	34, 102, 170, 208, 481, 484, 752
MfeI	CAATTG	2 cut(s)	403, 594
MflI	RGATCY	1 cut(s)	198
MlsI	TGGCCA	1 cut(s)	288
MluCI	AATT	4 cut(s)	190, 403, 534, 594
MluNI	TGGCCA	1 cut(s)	288
MlyI	GAGTC	2 cut(s)	371, 545
MmeI	TCCRAC	2 cut(s)	279, 495
Mox20I	TGGCCA	1 cut(s)	288
Mph1103I	ATGCAT	1 cut(s)	613
MroXI	GAANNNNTTC	1 cut(s)	635
MscI	TGGCCA	1 cut(s)	288
MseI	TTAA	1 cut(s)	509
Msp20I	TGGCCA	1 cut(s)	288
MspI	CCGG	5 cut(s)	8, 76, 116, 262, 527
MspR9I	CCNGG	3 cut(s)	9, 270, 669
MunI	CAATTG	2 cut(s)	403, 594
MvaI	CCWGG	2 cut(s)	270, 669
MvnI	CGCG	1 cut(s)	296
MwoI	GCNNNNNNNGC	4 cut(s)	48, 395, 536, 831
NciI	CCSGG	1 cut(s)	9
NcoI	CCATGG	1 cut(s)	762
NdeII	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
NlaIII	CATG	2 cut(s)	50, 766
NlaIV	GGNNCC	2 cut(s)	6, 89
NmeAIII	GCCGAG	1 cut(s)	163
NsiI	ATGCAT	1 cut(s)	613
NspV	TTCGAA	2 cut(s)	20, 207
PceI	AGGCCT	1 cut(s)	398
PcsI	WCGNNNNNNNCGW	1 cut(s)	255
PdmI	GAANNNNTTC	1 cut(s)	635
PfeI	GAWTC	5 cut(s)	442, 451, 631, 698, 839
PkrI	GCNGC	1 cut(s)	778
PleI	GAGTC	2 cut(s)	370, 545
PpsI	GAGTC	2 cut(s)	370, 545
PpuMI	RGGWCCY	1 cut(s)	87
Psp5II	RGGWCCY	1 cut(s)	87
Psp6I	CCWGG	2 cut(s)	268, 667
PspGI	CCWGG	2 cut(s)	268, 667
PspN4I	GGNNCC	2 cut(s)	6, 89
PspPI	GGNCC	2 cut(s)	87, 132
PspPPI	RGGWCCY	1 cut(s)	87
PsuI	RGATCY	1 cut(s)	198
SaqAI	TTAA	1 cut(s)	509
SatI	GCNGC	1 cut(s)	777
Sau3AI	GATC	7 cut(s)	97, 148, 198, 232, 291, 307, 343
Sau96I	GGNCC	2 cut(s)	87, 132
SchI	GAGTC	2 cut(s)	371, 545
ScrFI	CCNGG	3 cut(s)	9, 270, 669
SetI	ASST	8 cut(s)	44, 109, 125, 147, 327, 670, 747, 819
SexAI	ACCWGGT	1 cut(s)	667
SfaNI	GCATC	2 cut(s)	550, 598
SfcI	CTRYAG	1 cut(s)	455
SfuI	TTCGAA	2 cut(s)	20, 207
SinI	GGWCC	2 cut(s)	87, 132
Sse9I	AATT	4 cut(s)	190, 403, 534, 594
SseBI	AGGCCT	1 cut(s)	398
SsiI	CCGC	3 cut(s)	135, 779, 843
SspMI	CTAG	1 cut(s)	218
StuI	AGGCCT	1 cut(s)	398
StyD4I	CCNGG	3 cut(s)	7, 268, 667
StyI	CCWWGG	2 cut(s)	91, 762
TaaI	ACNGT	2 cut(s)	241, 502
TaqI	TCGA	6 cut(s)	20, 147, 153, 207, 365, 639
TasI	AATT	4 cut(s)	190, 403, 534, 594
TfiI	GAWTC	5 cut(s)	442, 451, 631, 698, 839
Tru1I	TTAA	1 cut(s)	509
Tru9I	TTAA	1 cut(s)	509
TscAI	CASTG	1 cut(s)	244
TseI	GCWGC	1 cut(s)	776
TspDTI	ATGAA	2 cut(s)	35, 652
TspGWI	ACGGA	1 cut(s)	191
TspRI	CASTG	1 cut(s)	244
VpaK11BI	GGWCC	2 cut(s)	87, 132
XapI	RAATTY	1 cut(s)	190
XmnI	GAANNNNTTC	1 cut(s)	635
XspI	CTAG	1 cut(s)	218
Zsp2I	ATGCAT	1 cut(s)	613

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.