Rmu_sc0000330.1_g000001

GRF1-interacting factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000330.1
Physical Location & Seq
Reverse (-)
1 .. 3311
3311 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000330.1_g000001.1.cds

Sequence Viewer

Length: 243 bp
atgcagcagcacctgatgcagatgcagcccatgatggcaggctattatcccaacagtgtcactactgatcacattcaacagtatttggacgagaacaagtcattgattctgaagattgttgagagccagaattcagggaaattgagtgaatgtgcagagaaccaagcaaggctacagcgaaatctgatgtaccttgctgccattgctgattcccaaccccaacctcccactatgcatcctcag

Protein Analysis

81

Amino Acids

9.28

Weight (kDa)

5.79

Isoelectric Point (pI)

62.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 130
AcuI CTGAAG 1 cut(s) 131
AfaI GTAC 1 cut(s) 191
AgsI TTSAA 1 cut(s) 77
AlwNI CAGNNNCTG 1 cut(s) 13
ApeKI GCWGC 4 cut(s) 4, 7, 25, 197
ApoI RAATTY 1 cut(s) 130
BbvI GCAGC 4 cut(s) 16, 19, 37, 184
BccI CCATC 1 cut(s) 28
BclI TGATCA 1 cut(s) 67
BfmI CTRYAG 1 cut(s) 173
BisI GCNGC 4 cut(s) 5, 8, 26, 198
BlsI GCNGC 4 cut(s) 6, 9, 27, 199
BmsI GCATC 2 cut(s) 6, 12
Bse3DI GCAATG 1 cut(s) 201
BseGI GGATG 1 cut(s) 235
BseMI GCAATG 1 cut(s) 201
BseXI GCAGC 4 cut(s) 16, 19, 37, 184
BsgI GTGCAG 1 cut(s) 174
Bsp143I GATC 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 201
BssMI GATC 1 cut(s) 67
Bst4CI ACNGT 2 cut(s) 56, 81
BstAPI GCANNNNNTGC 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 235
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstMWI GCNNNNNNNGC 3 cut(s) 16, 25, 203
BstSFI CTRYAG 1 cut(s) 173
BstV1I GCAGC 4 cut(s) 16, 19, 37, 184
BtsCI GGATG 1 cut(s) 235
BtsIMutI CAGTG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 40
CaiI CAGNNNCTG 1 cut(s) 13
Csp6I GTAC 1 cut(s) 190
CviAII CATG 1 cut(s) 31
CviJI RGCY 4 cut(s) 28, 42, 126, 172
CviKI_1 RGCY 4 cut(s) 28, 42, 126, 172
CviQI GTAC 1 cut(s) 190
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eco57I CTGAAG 1 cut(s) 131
EcoRI GAATTC 1 cut(s) 130
EcoT22I ATGCAT 1 cut(s) 237
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 233
FatI CATG 1 cut(s) 30
FbaI TGATCA 1 cut(s) 67
Fnu4HI GCNGC 4 cut(s) 5, 8, 26, 198
FokI GGATG 1 cut(s) 222
Fsp4HI GCNGC 4 cut(s) 5, 8, 26, 198
GluI GCNGC 4 cut(s) 5, 8, 26, 198
Hin1II CATG 1 cut(s) 34
HinfI GANTC 2 cut(s) 106, 209
Hpy188I TCNGA 2 cut(s) 111, 186
HpyCH4III ACNGT 2 cut(s) 56, 81
HpyCH4V TGCA 5 cut(s) 4, 19, 25, 155, 235
HpyF10VI GCNNNNNNNGC 3 cut(s) 16, 25, 203
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 1 cut(s) 34
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 4 cut(s) 24, 26, 120, 140
Lsp1109I GCAGC 4 cut(s) 16, 19, 37, 184
LweI GCATC 2 cut(s) 6, 12
MaeIII GTNAC 1 cut(s) 58
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 1 cut(s) 124
MluCI AATT 2 cut(s) 130, 140
MnlI CCTC 1 cut(s) 234
Mph1103I ATGCAT 1 cut(s) 237
MwoI GCNNNNNNNGC 3 cut(s) 16, 25, 203
NdeII GATC 1 cut(s) 67
NlaIII CATG 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 58
NsiI ATGCAT 1 cut(s) 237
PfeI GAWTC 2 cut(s) 106, 209
PkrI GCNGC 4 cut(s) 6, 9, 27, 199
PstNI CAGNNNCTG 1 cut(s) 13
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
SatI GCNGC 4 cut(s) 5, 8, 26, 198
Sau3AI GATC 1 cut(s) 67
SetI ASST 3 cut(s) 15, 195, 226
SfaNI GCATC 2 cut(s) 6, 12
SfcI CTRYAG 1 cut(s) 173
Sse9I AATT 2 cut(s) 130, 140
TaaI ACNGT 2 cut(s) 56, 81
TasI AATT 2 cut(s) 130, 140
TfiI GAWTC 2 cut(s) 106, 209
TscAI CASTG 1 cut(s) 61
TseFI GTSAC 1 cut(s) 58
TseI GCWGC 4 cut(s) 4, 7, 25, 197
Tsp45I GTSAC 1 cut(s) 58
TspRI CASTG 1 cut(s) 61
XapI RAATTY 1 cut(s) 130
Zsp2I ATGCAT 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.