Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000334.1

Orthogroup ID

OG0009545

Physical Location & Seq

Genomic Coordinates Reverse (-)

276649 .. 282389

Gene Structure 5741 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000334.1_g000056.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1242 bp

atgccatctggaggggactgtcgaccagatgacgcatcagaggggactgcagaccagaatattctagaggggactgccgaccagaatgttgtctggaggggactgccgaccagattaacaatacccattcacagttggaagcccatcatcaatctgaccaaatccaacatgagtattactaagccatatccagtgaccttttcatatctgatctcagcttcaaaaggcgattcgctgaagctcaaacgcatgctctatgcgctttatcatcctggaaattactatctgatccacatggattatgaagcaacggaggcagagcacagagacatagctgagtttgtgggtggaaatccagtttttggggaagtgggtaatgtttggattgtgggaaaacccaatttggtaacctatagaggaccaaccatgcttgctaccactattcatgctttggctttgctcttgaggacttgcagatgggattggttcatcaatctcagtgcttctgactaccctctaattactcaagatgatctgatccatgccttttctgacttgccaagagatctcaatttcattcagcactccagtcacttgggttggaaactgaataagagaggcaagcccattacaatagacccagcactctacagcctcaataaatcagaattatggtgggttattaaacaaagggctctcccaactgctttcaagctatacacaggttcagcttggacaatgatatcaagatcttttgccgagtattgcgtagtgggttgggacaatctgcccagaaccctcctcctctactacaccaactttgtctcatctccggaaggttacttccagactgtcatatgcaactcagaagactacaaaaacaccacgatcaaccatgacctccactacatttcatgggatacacctccaaagcagcatcccaggtctctcggactccgagactttaaaagaatggttcaaagcaaccgtccatttgctagaaagttcaagcaaaatgccccggtgcttaaaaaaattgatcaacaactgcttaaacgacgccgtggagaatttgcttatggtggatggtgttcggggaaagaaaagacgcagaggtcatgctcaggtttgcagagtgaaaattatggagttttaaggccaggacccggatctaggaggttgaagttcttgttaacaaaactcctttccacgaggaatcatcagaagcaacagtgcagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Branch

Protein Analysis

413

Amino Acids

47.34

Weight (kDa)

9.54

Isoelectric Point (pI)

41.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009545)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G03690 AT3G03690
fragaria_vesca	FvH4_6g14740 FvH4_6g14740 FvH4_6g14740
malus_domestica	MD12G1012100.v1.1 MD14G1009700.v1.1
prunus_persica	Prupe.7G016000_v2.0.a1
pyrus_communis	pycom12g00940 pycom14g00820 pycom14g00830
rosa_chinensis	RchiOBHm_Chr3g0495981
rosa_laevigata	RLG00000022573
rosa_multiflora	Rmu_sc0000334.1_g000056 Rmu_sc0018376.1_g000001
rosa_roxburghii	Rroxscaffold_6G00389660
rosa_rugosa	Rorug03G0278700
rosa_samantha	Rh3AG325500 Rh3BG362100 Rh3CG358100 Rh3DG361400
rosa_wichuraiana	Rw3G028460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1114
AccB7I	CCANNNNNTGG	1 cut(s)	362
AccI	GTMKAC	1 cut(s)	22
AccIII	TCCGGA	1 cut(s)	832
AclWI	GGATC	3 cut(s)	283, 532, 1177
AcsI	RAATTY	1 cut(s)	1070
AcuI	CTGAAG	1 cut(s)	257
AcyI	GRCGYC	1 cut(s)	1060
AfiI	CCNNNNNNNGG	4 cut(s)	11, 362, 1166, 1173
AgsI	TTSAA	5 cut(s)	222, 712, 980, 1009, 1183
AjnI	CCWGG	3 cut(s)	271, 941, 1159
AluBI	AGCT	5 cut(s)	218, 241, 335, 715, 731
AluI	AGCT	5 cut(s)	218, 241, 335, 715, 731
Alw21I	GWGCWC	1 cut(s)	324
Alw26I	GTCTC	4 cut(s)	321, 829, 951, 954
AlwI	GGATC	3 cut(s)	283, 532, 1177
Aor13HI	TCCGGA	1 cut(s)	832
AoxI	GGCC	1 cut(s)	1157
ApeKI	GCWGC	1 cut(s)	934
ApoI	RAATTY	1 cut(s)	1070
ArsI	GACNNNNNNTTYG	2 cut(s)	973, 1005
AspLEI	GCGC	1 cut(s)	262
AspS9I	GGNCC	2 cut(s)	419, 1163
AsuC2I	CCSGG	2 cut(s)	1022, 1167
AvaII	GGWCC	2 cut(s)	419, 1163
BanII	GRGCYC	1 cut(s)	697
BauI	CACGAG	1 cut(s)	1210
BbsI	GAAGAC	1 cut(s)	876
Bbv12I	GWGCWC	1 cut(s)	324
BbvI	GCAGC	1 cut(s)	946
BccI	CCATC	4 cut(s)	13, 152, 471, 1080
BceAI	ACGGC	1 cut(s)	1047
BciT130I	CCWGG	3 cut(s)	273, 943, 1161
BciVI	GTATCC	1 cut(s)	913
BclI	TGATCA	1 cut(s)	1039
BcnI	CCSGG	2 cut(s)	1022, 1167
BcoDI	GTCTC	4 cut(s)	321, 829, 951, 954
BfaI	CTAG	3 cut(s)	65, 999, 1173
BfmI	CTRYAG	3 cut(s)	48, 412, 649
BfuI	GTATCC	1 cut(s)	913
BglII	AGATCT	2 cut(s)	565, 749
BisI	GCNGC	1 cut(s)	935
BlsI	GCNGC	1 cut(s)	936
Bme1390I	CCNGG	5 cut(s)	273, 943, 1022, 1161, 1167
Bme18I	GGWCC	2 cut(s)	419, 1163
BmgT120I	GGNCC	2 cut(s)	419, 1163
BmiI	GGNNCC	1 cut(s)	1165
BmrFI	CCNGG	5 cut(s)	273, 943, 1022, 1161, 1167
BmsI	GCATC	2 cut(s)	44, 946
BpiI	GAAGAC	1 cut(s)	876
BpmI	CTGGAG	3 cut(s)	30, 115, 571
Bpu10I	CCTNAGC	1 cut(s)	1123
BpuEI	CTTGAG	2 cut(s)	484, 510
BpuMI	CCSGG	2 cut(s)	1022, 1167
BsaHI	GRCGYC	1 cut(s)	1060
BsaI	GGTCTC	1 cut(s)	951
BsaJI	CCNNGG	3 cut(s)	941, 1020, 1063
BsaWI	WCCGGW	1 cut(s)	832
Bsc4I	CCNNNNNNNGG	4 cut(s)	11, 362, 1166, 1173
Bse1I	ACTGG	3 cut(s)	191, 356, 588
BseAI	TCCGGA	1 cut(s)	832
BseBI	CCWGG	3 cut(s)	273, 943, 1161
BseDI	CCNNGG	3 cut(s)	941, 1020, 1063
BseGI	GGATG	3 cut(s)	268, 937, 1091
BseLI	CCNNNNNNNGG	4 cut(s)	11, 362, 1166, 1173
BseMII	CTCAG	5 cut(s)	228, 327, 511, 879, 1137
BseNI	ACTGG	3 cut(s)	191, 356, 588
BseRI	GAGGAG	2 cut(s)	791, 794
BseXI	GCAGC	1 cut(s)	946
BseYI	CCCAGC	1 cut(s)	640
BshFI	GGCC	1 cut(s)	1159
BsiHKAI	GWGCWC	1 cut(s)	324
BsiSI	CCGG	3 cut(s)	833, 1022, 1167
BslFI	GGGAC	5 cut(s)	29, 58, 85, 114, 794
BslI	CCNNNNNNNGG	4 cut(s)	11, 362, 1166, 1173
BsmAI	GTCTC	4 cut(s)	321, 829, 951, 954
BsmFI	GGGAC	5 cut(s)	29, 58, 85, 114, 794
BsnI	GGCC	1 cut(s)	1159
Bso31I	GGTCTC	1 cut(s)	951
Bsp1286I	GDGCHC	2 cut(s)	324, 697
Bsp13I	TCCGGA	1 cut(s)	832
Bsp143I	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
BspANI	GGCC	1 cut(s)	1159
BspCNI	CTCAG	5 cut(s)	227, 328, 510, 878, 1136
BspEI	TCCGGA	1 cut(s)	832
BspLI	GGNNCC	1 cut(s)	1165
BspMAI	CTGCAG	1 cut(s)	52
BspPI	GGATC	3 cut(s)	283, 532, 1177
BspTNI	GGTCTC	1 cut(s)	951
BsrI	ACTGG	3 cut(s)	191, 356, 588
BssECI	CCNNGG	3 cut(s)	941, 1020, 1063
BssMI	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
BssNI	GRCGYC	1 cut(s)	1060
BssSI	CACGAG	1 cut(s)	1210
Bst2BI	CACGAG	1 cut(s)	1210
Bst2UI	CCWGG	3 cut(s)	273, 943, 1161
Bst4CI	ACNGT	5 cut(s)	20, 134, 853, 989, 1233
BstACI	GRCGYC	1 cut(s)	1060
BstC8I	GCNNGC	3 cut(s)	251, 432, 623
BstDEI	CTNAG	6 cut(s)	180, 214, 336, 497, 865, 1123
BstDSI	CCRYGG	1 cut(s)	1063
BstEII	GGTNACC	1 cut(s)	406
BstF5I	GGATG	3 cut(s)	268, 937, 1091
BstHHI	GCGC	1 cut(s)	262
BstKTI	GATC	9 cut(s)	213, 291, 535, 540, 568, 752, 891, 1042, 1172
BstMAI	GTCTC	4 cut(s)	321, 829, 951, 954
BstMBI	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
BstMWI	GCNNNNNNNGC	2 cut(s)	259, 314
BstNI	CCWGG	3 cut(s)	273, 943, 1161
BstNSI	RCATGY	1 cut(s)	253
BstPI	GGTNACC	1 cut(s)	406
BstSCI	CCNGG	5 cut(s)	271, 941, 1020, 1159, 1165
BstSFI	CTRYAG	3 cut(s)	48, 412, 649
BstV1I	GCAGC	1 cut(s)	946
BstV2I	GAAGAC	1 cut(s)	876
BstX2I	RGATCY	3 cut(s)	565, 749, 1169
BstXI	CCANNNNNNTGG	1 cut(s)	595
BstYI	RGATCY	3 cut(s)	565, 749, 1169
BsuI	GTATCC	1 cut(s)	913
BsuRI	GGCC	1 cut(s)	1159
BtgI	CCRYGG	1 cut(s)	1063
BtsCI	GGATG	3 cut(s)	268, 937, 1091
BtsIMutI	CAGTG	3 cut(s)	198, 505, 1238
Cac8I	GCNNGC	3 cut(s)	251, 432, 623
CfoI	GCGC	1 cut(s)	262
Cfr13I	GGNCC	2 cut(s)	419, 1163
CseI	GACGC	3 cut(s)	41, 1068, 1117
CviAII	CATG	9 cut(s)	169, 250, 295, 427, 446, 542, 896, 915, 1119
DdeI	CTNAG	6 cut(s)	180, 214, 336, 497, 865, 1123
DpnI	GATC	9 cut(s)	212, 290, 534, 539, 567, 751, 890, 1041, 1171
DpnII	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
DraI	TTTAAA	1 cut(s)	967
DrdI	GACNNNNNNGTC	1 cut(s)	1114
DseDI	GACNNNNNNGTC	1 cut(s)	1114
Eco24I	GRGCYC	1 cut(s)	697
Eco31I	GGTCTC	1 cut(s)	951
Eco32I	GATATC	1 cut(s)	744
Eco47I	GGWCC	2 cut(s)	419, 1163
Eco57I	CTGAAG	1 cut(s)	257
Eco91I	GGTNACC	1 cut(s)	406
EcoO109I	RGGNCCY	1 cut(s)	1163
EcoO65I	GGTNACC	1 cut(s)	406
EcoRII	CCWGG	3 cut(s)	271, 941, 1159
EcoRV	GATATC	1 cut(s)	744
EcoT38I	GRGCYC	1 cut(s)	697
FaeI	CATG	9 cut(s)	172, 253, 298, 430, 449, 545, 899, 918, 1122
FaqI	GGGAC	5 cut(s)	29, 58, 85, 114, 794
FatI	CATG	9 cut(s)	168, 249, 294, 426, 445, 541, 895, 914, 1118
FauNDI	CATATG	1 cut(s)	857
FbaI	TGATCA	1 cut(s)	1039
FblI	GTMKAC	1 cut(s)	22
Fnu4HI	GCNGC	1 cut(s)	935
FokI	GGATG	3 cut(s)	255, 924, 1098
FriOI	GRGCYC	1 cut(s)	697
Fsp4HI	GCNGC	1 cut(s)	935
FspBI	CTAG	3 cut(s)	65, 999, 1173
GlaI	GCGC	1 cut(s)	261
GluI	GCNGC	1 cut(s)	935
GsaI	CCCAGC	1 cut(s)	644
GsuI	CTGGAG	3 cut(s)	30, 115, 571
HaeIII	GGCC	1 cut(s)	1159
HapII	CCGG	3 cut(s)	833, 1022, 1167
HgaI	GACGC	3 cut(s)	41, 1068, 1117
HhaI	GCGC	1 cut(s)	262
Hin1I	GRCGYC	1 cut(s)	1060
Hin1II	CATG	9 cut(s)	172, 253, 298, 430, 449, 545, 899, 918, 1122
Hin6I	GCGC	1 cut(s)	260
HinP1I	GCGC	1 cut(s)	260
HincII	GTYRAC	2 cut(s)	23, 1194
HindII	GTYRAC	2 cut(s)	23, 1194
HinfI	GANTC	3 cut(s)	230, 954, 1216
HpaI	GTTAAC	1 cut(s)	1194
HpaII	CCGG	3 cut(s)	833, 1022, 1167
Hpy166II	GTNNAC	2 cut(s)	23, 1194
Hpy188III	TCNNGA	8 cut(s)	9, 65, 94, 463, 527, 747, 833, 847
Hpy8I	GTNNAC	2 cut(s)	23, 1194
Hpy99I	CGWCG	1 cut(s)	1062
HpyAV	CCTTC	1 cut(s)	830
HpyCH4III	ACNGT	5 cut(s)	20, 134, 853, 989, 1233
HpyCH4V	TGCA	5 cut(s)	50, 474, 861, 1132, 1236
HpyF10VI	GCNNNNNNNGC	2 cut(s)	259, 314
HpyF3I	CTNAG	6 cut(s)	180, 214, 336, 497, 865, 1123
Hsp92I	GRCGYC	1 cut(s)	1060
Hsp92II	CATG	9 cut(s)	172, 253, 298, 430, 449, 545, 899, 918, 1122
HspAI	GCGC	1 cut(s)	260
Kpn2I	TCCGGA	1 cut(s)	832
Ksp22I	TGATCA	1 cut(s)	1039
KspAI	GTTAAC	1 cut(s)	1194
Kzo9I	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
Lsp1109I	GCAGC	1 cut(s)	946
LweI	GCATC	2 cut(s)	44, 946
MaeI	CTAG	3 cut(s)	65, 999, 1173
MaeIII	GTNAC	4 cut(s)	193, 406, 590, 839
MalI	GATC	9 cut(s)	212, 290, 534, 539, 567, 751, 890, 1041, 1171
MboI	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
MboII	GAAGA	1 cut(s)	881
MflI	RGATCY	3 cut(s)	565, 749, 1169
MhlI	GDGCHC	2 cut(s)	324, 697
MluCI	AATT	8 cut(s)	277, 400, 519, 571, 668, 1035, 1070, 1141
MlyI	GAGTC	1 cut(s)	948
MmeI	TCCRAC	3 cut(s)	116, 189, 581
MroI	TCCGGA	1 cut(s)	832
MseI	TTAA	7 cut(s)	116, 684, 966, 1029, 1053, 1154, 1193
MspI	CCGG	3 cut(s)	833, 1022, 1167
MspR9I	CCNGG	5 cut(s)	273, 943, 1022, 1161, 1167
MvaI	CCWGG	3 cut(s)	273, 943, 1161
MwoI	GCNNNNNNNGC	2 cut(s)	259, 314
NciI	CCSGG	2 cut(s)	1022, 1167
NdeI	CATATG	1 cut(s)	857
NdeII	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
NlaIII	CATG	9 cut(s)	172, 253, 298, 430, 449, 545, 899, 918, 1122
NlaIV	GGNNCC	1 cut(s)	1165
NmeAIII	GCCGAG	1 cut(s)	784
NmuCI	GTSAC	2 cut(s)	193, 590
NspI	RCATGY	1 cut(s)	253
PaeI	GCATGC	1 cut(s)	253
PfeI	GAWTC	2 cut(s)	230, 1216
PflMI	CCANNNNNTGG	1 cut(s)	362
PfoI	TCCNGGA	1 cut(s)	271
PkrI	GCNGC	1 cut(s)	936
PleI	GAGTC	1 cut(s)	948
PpsI	GAGTC	1 cut(s)	948
PpuMI	RGGWCCY	1 cut(s)	1163
Psp5II	RGGWCCY	1 cut(s)	1163
Psp6I	CCWGG	3 cut(s)	271, 941, 1159
PspEI	GGTNACC	1 cut(s)	406
PspFI	CCCAGC	1 cut(s)	640
PspGI	CCWGG	3 cut(s)	271, 941, 1159
PspN4I	GGNNCC	1 cut(s)	1165
PspPI	GGNCC	2 cut(s)	419, 1163
PspPPI	RGGWCCY	1 cut(s)	1163
PstI	CTGCAG	1 cut(s)	52
PsuI	RGATCY	3 cut(s)	565, 749, 1169
SalI	GTCGAC	1 cut(s)	21
SaqAI	TTAA	7 cut(s)	116, 684, 966, 1029, 1053, 1154, 1193
SatI	GCNGC	1 cut(s)	935
Sau3AI	GATC	9 cut(s)	210, 288, 532, 537, 565, 749, 888, 1039, 1169
Sau96I	GGNCC	2 cut(s)	419, 1163
SchI	GAGTC	1 cut(s)	948
ScrFI	CCNGG	5 cut(s)	273, 943, 1022, 1161, 1167
SduI	GDGCHC	2 cut(s)	324, 697
SfaNI	GCATC	2 cut(s)	44, 946
SfcI	CTRYAG	3 cut(s)	48, 412, 649
SinI	GGWCC	2 cut(s)	419, 1163
SmlI	CTYRAG	2 cut(s)	463, 525
SmoI	CTYRAG	2 cut(s)	463, 525
SphI	GCATGC	1 cut(s)	253
Sse9I	AATT	8 cut(s)	277, 400, 519, 571, 668, 1035, 1070, 1141
SspI	AATATT	1 cut(s)	61
SspMI	CTAG	3 cut(s)	65, 999, 1173
StyD4I	CCNGG	5 cut(s)	271, 941, 1020, 1159, 1165
TaaI	ACNGT	5 cut(s)	20, 134, 853, 989, 1233
TaqI	TCGA	1 cut(s)	22
TasI	AATT	8 cut(s)	277, 400, 519, 571, 668, 1035, 1070, 1141
TfiI	GAWTC	2 cut(s)	230, 1216
Tru1I	TTAA	7 cut(s)	116, 684, 966, 1029, 1053, 1154, 1193
Tru9I	TTAA	7 cut(s)	116, 684, 966, 1029, 1053, 1154, 1193
TscAI	CASTG	3 cut(s)	198, 505, 1238
TseFI	GTSAC	2 cut(s)	193, 590
TseI	GCWGC	1 cut(s)	934
Tsp45I	GTSAC	2 cut(s)	193, 590
TspDTI	ATGAA	6 cut(s)	192, 318, 434, 478, 565, 903
TspGWI	ACGGA	1 cut(s)	326
TspRI	CASTG	3 cut(s)	198, 505, 1238
Van91I	CCANNNNNTGG	1 cut(s)	362
VpaK11BI	GGWCC	2 cut(s)	419, 1163
XapI	RAATTY	1 cut(s)	1070
XbaI	TCTAGA	1 cut(s)	64
XceI	RCATGY	1 cut(s)	253
XmiI	GTMKAC	1 cut(s)	22
XspI	CTAG	3 cut(s)	65, 999, 1173

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.