Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000354.1

Orthogroup ID

OG0008767

Physical Location & Seq

Genomic Coordinates Reverse (-)

47991 .. 49645

Gene Structure 1655 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000354.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 645 bp

atgtctggatatcctgccaggggcagtagagccatctttgccagctacagagattctttgggccagatccagaaatttgcttttcgatttttgtcagtcaatgaagcagagaagttcataactcttatgaaggagattttcaaggaagggagggatattcaacctcttaatactgactatggatctgaaatttcatcacaatctgagttcatgtcttccaatagacctctaaacagaacttccaaggacttggttgtcatgactcctgttcacagtcattctcctcaaatatcaccaagcttaatgacggcttatactcctcaaatgtcaccaagcttaatgaaggattatacacctcaaatgtcaccaacctggaaacatgaagcagctcaacacagacaaacgcagcacatgtcacctattcagaactttcagagcaactttgctgcctttcctcctagtttcacctcattagtgtccaactgtcaacctctggttgagcaagctccagcacaatcaactgcatcaaaggaagtcgatctcaaggccctaattgcgagatgtatggaagactcttccttccaagatatattgagccaagttgagacagttatgggcgaaatgggggctgatttgaagctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000280 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006996 GO:0007049 GO:0007059 GO:0007127 GO:0007129 GO:0008150 GO:0009987 GO:0016043 GO:0022402 GO:0022414 GO:0044424 GO:0044464 GO:0045132 GO:0045143 GO:0048285 GO:0051276 GO:0051321 GO:0061982 GO:0070192 GO:0071840 GO:0098813 GO:0140013 GO:1903046

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

214

Amino Acids

23.95

Weight (kDa)

6.2

Isoelectric Point (pI)

57.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008767)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10710 AT1G10710
fragaria_vesca	FvH4_4g25900 FvH4_4g25900 FvH4_4g25900
malus_domestica	MD13G1097800.v1.1 MD13G1097900.v1.1
prunus_persica	Prupe.1G247500_v2.0.a1 Prupe.1G247600_v2.0.a1 Prupe.1G247600_v2.0.a1
pyrus_communis	pycom13g08550
rosa_chinensis	RchiOBHm_Chr4g0433351
rosa_laevigata	RLG00000006761
rosa_multiflora	Rmu_sc0000354.1_g000013 Rmu_sc0000354.1_g000014 Rmu_sc0000759.1_g000014
rosa_roxburghii	Rroxscaffold_5G00374900
rosa_rugosa	Rorug04G0268000
rosa_samantha	Rh4AG322800 Rh4BG330500 Rh4CG345900 Rh4DG327000
rosa_wichuraiana	Rw4G027940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	254
AclWI	GGATC	2 cut(s)	61, 190
AcsI	RAATTY	2 cut(s)	74, 189
AfiI	CCNNNNNNNGG	1 cut(s)	20
AflIII	ACRYGT	1 cut(s)	411
AgsI	TTSAA	3 cut(s)	142, 161, 637
AjnI	CCWGG	2 cut(s)	17, 371
AluBI	AGCT	6 cut(s)	45, 300, 336, 389, 506, 640
AluI	AGCT	6 cut(s)	45, 300, 336, 389, 506, 640
Alw26I	GTCTC	1 cut(s)	599
AlwI	GGATC	2 cut(s)	61, 190
AoxI	GGCC	2 cut(s)	61, 546
ApeKI	GCWGC	3 cut(s)	386, 406, 446
ApoI	RAATTY	2 cut(s)	74, 189
AspS9I	GGNCC	2 cut(s)	61, 547
AsuHPI	GGTGA	5 cut(s)	285, 321, 357, 408, 457
BbsI	GAAGAC	2 cut(s)	207, 576
BbvI	GCAGC	3 cut(s)	398, 418, 433
BccI	CCATC	1 cut(s)	41
BceAI	ACGGC	1 cut(s)	324
BciT130I	CCWGG	2 cut(s)	19, 373
BcoDI	GTCTC	1 cut(s)	599
BfaI	CTAG	1 cut(s)	459
BfmI	CTRYAG	2 cut(s)	46, 641
BisI	GCNGC	3 cut(s)	387, 407, 447
BlsI	GCNGC	3 cut(s)	388, 408, 448
Bme1390I	CCNGG	2 cut(s)	19, 373
BmgT120I	GGNCC	2 cut(s)	61, 547
BmrFI	CCNGG	2 cut(s)	19, 373
BmsI	GCATC	1 cut(s)	533
BpiI	GAAGAC	2 cut(s)	207, 576
BpmI	CTGGAG	1 cut(s)	492
BpuEI	CTTGAG	1 cut(s)	527
BsaJI	CCNNGG	2 cut(s)	18, 243
Bsc4I	CCNNNNNNNGG	1 cut(s)	20
BseBI	CCWGG	2 cut(s)	19, 373
BseDI	CCNNGG	2 cut(s)	18, 243
BseLI	CCNNNNNNNGG	1 cut(s)	20
BseMII	CTCAG	1 cut(s)	195
BseRI	GAGGAG	2 cut(s)	273, 309
BseXI	GCAGC	3 cut(s)	398, 418, 433
BshFI	GGCC	2 cut(s)	63, 548
BslI	CCNNNNNNNGG	1 cut(s)	20
BsmAI	GTCTC	1 cut(s)	599
BsnI	GGCC	2 cut(s)	63, 548
Bsp143I	GATC	3 cut(s)	66, 182, 538
BspANI	GGCC	2 cut(s)	63, 548
BspCNI	CTCAG	1 cut(s)	196
BspHI	TCATGA	1 cut(s)	258
BspPI	GGATC	2 cut(s)	61, 190
BssECI	CCNNGG	2 cut(s)	18, 243
BssMI	GATC	3 cut(s)	66, 182, 538
BssT1I	CCWWGG	1 cut(s)	243
Bst2UI	CCWGG	2 cut(s)	19, 373
Bst4CI	ACNGT	3 cut(s)	275, 485, 610
Bst6I	CTCTTC	1 cut(s)	580
BstC8I	GCNNGC	2 cut(s)	43, 504
BstDEI	CTNAG	1 cut(s)	204
BstKTI	GATC	3 cut(s)	69, 185, 541
BstMAI	GTCTC	1 cut(s)	599
BstMBI	GATC	3 cut(s)	66, 182, 538
BstMWI	GCNNNNNNNGC	2 cut(s)	38, 554
BstNI	CCWGG	2 cut(s)	19, 373
BstNSI	RCATGY	1 cut(s)	415
BstSCI	CCNGG	2 cut(s)	17, 371
BstSFI	CTRYAG	2 cut(s)	46, 641
BstV1I	GCAGC	3 cut(s)	398, 418, 433
BstV2I	GAAGAC	2 cut(s)	207, 576
BstX2I	RGATCY	2 cut(s)	66, 182
BstXI	CCANNNNNNTGG	1 cut(s)	250
BstYI	RGATCY	2 cut(s)	66, 182
BsuRI	GGCC	2 cut(s)	63, 548
Cac8I	GCNNGC	2 cut(s)	43, 504
CciI	TCATGA	1 cut(s)	258
Cfr13I	GGNCC	2 cut(s)	61, 547
CviAII	CATG	4 cut(s)	211, 259, 380, 412
DdeI	CTNAG	1 cut(s)	204
DpnI	GATC	3 cut(s)	68, 184, 540
DpnII	GATC	3 cut(s)	66, 182, 538
DrdI	GACNNNNNNGTC	1 cut(s)	254
DseDI	GACNNNNNNGTC	1 cut(s)	254
Eam1104I	CTCTTC	1 cut(s)	580
EarI	CTCTTC	1 cut(s)	580
Eco130I	CCWWGG	1 cut(s)	243
Eco32I	GATATC	1 cut(s)	11
EcoO109I	RGGNCCY	1 cut(s)	547
EcoRII	CCWGG	2 cut(s)	17, 371
EcoRV	GATATC	1 cut(s)	11
EcoT14I	CCWWGG	1 cut(s)	243
ErhI	CCWWGG	1 cut(s)	243
FaeI	CATG	4 cut(s)	214, 262, 383, 415
FatI	CATG	4 cut(s)	210, 258, 379, 411
Fnu4HI	GCNGC	3 cut(s)	387, 407, 447
Fsp4HI	GCNGC	3 cut(s)	387, 407, 447
FspBI	CTAG	1 cut(s)	459
GluI	GCNGC	3 cut(s)	387, 407, 447
GsuI	CTGGAG	1 cut(s)	492
HaeIII	GGCC	2 cut(s)	63, 548
Hin1II	CATG	4 cut(s)	214, 262, 383, 415
HincII	GTYRAC	1 cut(s)	488
HindII	GTYRAC	1 cut(s)	488
HindIII	AAGCTT	2 cut(s)	298, 334
HinfI	GANTC	3 cut(s)	53, 262, 572
HphI	GGTGA	5 cut(s)	285, 321, 357, 408, 457
Hpy166II	GTNNAC	2 cut(s)	271, 488
Hpy188I	TCNGA	4 cut(s)	187, 205, 426, 435
Hpy188III	TCNNGA	3 cut(s)	6, 70, 259
Hpy8I	GTNNAC	2 cut(s)	271, 488
HpyAV	CCTTC	4 cut(s)	124, 140, 337, 589
HpyCH4III	ACNGT	3 cut(s)	275, 485, 610
HpyCH4V	TGCA	1 cut(s)	524
HpyF10VI	GCNNNNNNNGC	2 cut(s)	38, 554
HpyF3I	CTNAG	1 cut(s)	204
Hsp92II	CATG	4 cut(s)	214, 262, 383, 415
Kzo9I	GATC	3 cut(s)	66, 182, 538
LmnI	GCTCC	1 cut(s)	511
Lsp1109I	GCAGC	3 cut(s)	398, 418, 433
LweI	GCATC	1 cut(s)	533
MaeI	CTAG	1 cut(s)	459
MaeIII	GTNAC	3 cut(s)	327, 363, 414
MalI	GATC	3 cut(s)	68, 184, 540
MboI	GATC	3 cut(s)	66, 182, 538
MboII	GAAGA	3 cut(s)	207, 567, 581
MflI	RGATCY	2 cut(s)	66, 182
MluCI	AATT	3 cut(s)	74, 189, 552
MlyI	GAGTC	2 cut(s)	256, 566
MmeI	TCCRAC	1 cut(s)	504
MnlI	CCTC	9 cut(s)	144, 174, 237, 294, 330, 366, 465, 478, 501
MseI	TTAA	3 cut(s)	168, 302, 338
MspR9I	CCNGG	2 cut(s)	19, 373
MvaI	CCWGG	2 cut(s)	19, 373
MwoI	GCNNNNNNNGC	2 cut(s)	38, 554
NdeII	GATC	3 cut(s)	66, 182, 538
NlaIII	CATG	4 cut(s)	214, 262, 383, 415
NmuCI	GTSAC	3 cut(s)	327, 363, 414
NspI	RCATGY	1 cut(s)	415
PagI	TCATGA	1 cut(s)	258
PciI	ACATGT	1 cut(s)	411
PfeI	GAWTC	1 cut(s)	53
PkrI	GCNGC	3 cut(s)	388, 408, 448
PleI	GAGTC	2 cut(s)	256, 566
PpsI	GAGTC	2 cut(s)	256, 566
PscI	ACATGT	1 cut(s)	411
Psp6I	CCWGG	2 cut(s)	17, 371
PspGI	CCWGG	2 cut(s)	17, 371
PspPI	GGNCC	2 cut(s)	61, 547
PsuI	RGATCY	2 cut(s)	66, 182
SaqAI	TTAA	3 cut(s)	168, 302, 338
SatI	GCNGC	3 cut(s)	387, 407, 447
Sau3AI	GATC	3 cut(s)	66, 182, 538
Sau96I	GGNCC	2 cut(s)	61, 547
SchI	GAGTC	2 cut(s)	256, 566
ScrFI	CCNGG	2 cut(s)	19, 373
SfaNI	GCATC	1 cut(s)	533
SfcI	CTRYAG	2 cut(s)	46, 641
SmlI	CTYRAG	1 cut(s)	542
SmoI	CTYRAG	1 cut(s)	542
Sse9I	AATT	3 cut(s)	74, 189, 552
SspMI	CTAG	1 cut(s)	459
StyD4I	CCNGG	2 cut(s)	17, 371
StyI	CCWWGG	1 cut(s)	243
TaaI	ACNGT	3 cut(s)	275, 485, 610
TaqI	TCGA	2 cut(s)	85, 537
TasI	AATT	3 cut(s)	74, 189, 552
TfiI	GAWTC	1 cut(s)	53
Tru1I	TTAA	3 cut(s)	168, 302, 338
Tru9I	TTAA	3 cut(s)	168, 302, 338
TseFI	GTSAC	3 cut(s)	327, 363, 414
TseI	GCWGC	3 cut(s)	386, 406, 446
Tsp45I	GTSAC	3 cut(s)	327, 363, 414
TspDTI	ATGAA	7 cut(s)	106, 117, 143, 183, 199, 356, 396
XapI	RAATTY	2 cut(s)	74, 189
XceI	RCATGY	1 cut(s)	415
XspI	CTAG	1 cut(s)	459

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.