Rmu_sc0000388.1_g000049

Cold acclimation protein WCOR413

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000388.1
Physical Location & Seq
Reverse (-)
254605 .. 255168
564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000388.1_g000049.1.cds

Sequence Viewer

Length: 387 bp
atgcaaagtaaccttcttgtaatgtatttgtttacaagcttcccgacagtgttgtttaaaattctgaggggacagttcggctattgggtttcatttcttgctgtttctgcaaacctcttctttccgcaaacttttccagtttctcgttttctcctatttgtggtcacaccttcttgggtggctaatggactgcgtgatagtactgcgggtggcatcttttgtctaattattggagttctagttgtcataacagcgattcaaggaattggaggttttagtgattgttttagtaattgtgaatgcaattgtcattgctttgcatactgtcttagtataggatttatcttcttctttacaattttgtatctgtgctcggaaacttggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.34

Weight (kDa)

6.49

Isoelectric Point (pI)

35.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013591)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 125, 206
AcsI RAATTY 1 cut(s) 60
AfaI GTAC 1 cut(s) 202
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 1 cut(s) 260
AluBI AGCT 1 cut(s) 39
AluI AGCT 1 cut(s) 39
Alw21I GWGCWC 1 cut(s) 374
ApoI RAATTY 1 cut(s) 60
Bbv12I GWGCWC 1 cut(s) 374
BfaI CTAG 1 cut(s) 239
BmcAI AGTACT 1 cut(s) 202
BmsI GCATC 1 cut(s) 222
BsaXI ACNNNNNCTCC 2 cut(s) 225, 255
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 310
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMI GCAATG 1 cut(s) 310
BseMII CTCAG 1 cut(s) 56
BseNI ACTGG 1 cut(s) 137
BsiHKAI GWGCWC 1 cut(s) 374
BslFI GGGAC 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 84
BsmI GAATGC 1 cut(s) 305
Bsp1286I GDGCHC 1 cut(s) 374
BspACI CCGC 2 cut(s) 125, 206
BspCNI CTCAG 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 310
BsrI ACTGG 1 cut(s) 137
Bst4CI ACNGT 3 cut(s) 49, 75, 326
Bst6I CTCTTC 1 cut(s) 122
BstDEI CTNAG 2 cut(s) 65, 329
BstMWI GCNNNNNNNGC 1 cut(s) 107
BtsIMutI CAGTG 1 cut(s) 54
Csp6I GTAC 1 cut(s) 201
CviJI RGCY 3 cut(s) 39, 81, 182
CviKI_1 RGCY 3 cut(s) 39, 81, 182
CviQI GTAC 1 cut(s) 201
DdeI CTNAG 2 cut(s) 65, 329
DraI TTTAAA 1 cut(s) 58
Eam1104I CTCTTC 1 cut(s) 122
EarI CTCTTC 1 cut(s) 122
FaiI YATR 3 cut(s) 248, 322, 335
FaqI GGGAC 1 cut(s) 84
FauI CCCGC 1 cut(s) 199
FspBI CTAG 1 cut(s) 239
HindIII AAGCTT 1 cut(s) 37
HinfI GANTC 1 cut(s) 256
Hpy166II GTNNAC 1 cut(s) 33
Hpy188I TCNGA 2 cut(s) 66, 376
Hpy188III TCNNGA 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 33
HpyAV CCTTC 2 cut(s) 23, 180
HpyCH4III ACNGT 3 cut(s) 49, 75, 326
HpyCH4V TGCA 4 cut(s) 4, 110, 303, 320
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
HpyF3I CTNAG 2 cut(s) 65, 329
LpnPI CCDG 1 cut(s) 150
LweI GCATC 1 cut(s) 222
MaeI CTAG 1 cut(s) 239
MaeIII GTNAC 2 cut(s) 8, 163
MboII GAAGA 3 cut(s) 109, 337, 340
MfeI CAATTG 1 cut(s) 304
MhlI GDGCHC 1 cut(s) 374
MluCI AATT 6 cut(s) 60, 225, 264, 292, 304, 357
MnlI CCTC 3 cut(s) 60, 125, 263
MseI TTAA 1 cut(s) 57
MunI CAATTG 1 cut(s) 304
Mva1269I GAATGC 1 cut(s) 305
MwoI GCNNNNNNNGC 1 cut(s) 107
NmuCI GTSAC 1 cut(s) 163
PctI GAATGC 1 cut(s) 305
PfeI GAWTC 1 cut(s) 256
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
SaqAI TTAA 1 cut(s) 57
ScaI AGTACT 1 cut(s) 202
SduI GDGCHC 1 cut(s) 374
SetI ASST 5 cut(s) 15, 41, 117, 172, 274
SfaNI GCATC 1 cut(s) 222
Sse9I AATT 6 cut(s) 60, 225, 264, 292, 304, 357
SsiI CCGC 2 cut(s) 125, 206
SspMI CTAG 1 cut(s) 239
TaaI ACNGT 3 cut(s) 49, 75, 326
TasI AATT 6 cut(s) 60, 225, 264, 292, 304, 357
TatI WGTACW 1 cut(s) 200
TfiI GAWTC 1 cut(s) 256
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TscAI CASTG 1 cut(s) 54
TseFI GTSAC 1 cut(s) 163
Tsp45I GTSAC 1 cut(s) 163
TspDTI ATGAA 1 cut(s) 81
TspRI CASTG 1 cut(s) 54
XapI RAATTY 1 cut(s) 60
XspI CTAG 1 cut(s) 239
ZrmI AGTACT 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.