Rmu_sc0000394.1_g000029

Histone-lysine n-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000394.1
Physical Location & Seq
Reverse (-)
79226 .. 80158
933 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000394.1_g000029.1.cds

Sequence Viewer

Length: 597 bp
atgggttcccttgcttctgcattaacagcattgcacatggaattcagtgatgatctcacttacatgcctggcatggctcctagatctgcaaatcattccaagtttgaagatggtggaatgcagattctttccaaagaagatactgagacattggaacagtgcagagccatgtgtaaaagaggagaatgccctcctcttacggttgttttcgatgcatgtgaaggttttacagtagaggctgatgagcagattaaggatctcacttttattgctgagtatacgggtgatgtcgattacattaagcatcgggagaatgacgactgtgacagcatgatgacccttctcttagcactcaatccatctaagagtcttgtcatctgtcctgataaacgtggaaacattgctcgatttatcaatggaatcaacaaccattctctggagggtaagaagaagcagaattgtaaatgtgtgagatacagtgtcaacgatgaatgccgggtcttattggttgctactcgtgatattgctaaaggagagaggttatattatgattataatggatatgagcatgaataccctactgaaaattttgtctaa

Protein Analysis

198

Amino Acids

22.38

Weight (kDa)

4.91

Isoelectric Point (pI)

34.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 555
AccB7I CCANNNNNTGG 1 cut(s) 436
AccI GTMKAC 1 cut(s) 278
AclWI GGATC 1 cut(s) 264
AcsI RAATTY 2 cut(s) 41, 586
AfiI CCNNNNNNNGG 1 cut(s) 436
AgsI TTSAA 1 cut(s) 107
AjnI CCWGG 1 cut(s) 67
Alw26I GTCTC 1 cut(s) 140
AlwI GGATC 1 cut(s) 264
ApoI RAATTY 2 cut(s) 41, 586
AsuC2I CCSGG 1 cut(s) 497
AsuHPI GGTGA 1 cut(s) 296
BauI CACGAG 1 cut(s) 516
BccI CCATC 2 cut(s) 104, 367
BciT130I CCWGG 1 cut(s) 69
BcnI CCSGG 1 cut(s) 497
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 1 cut(s) 81
BglII AGATCT 1 cut(s) 83
Bme1390I CCNGG 2 cut(s) 69, 497
BmiI GGNNCC 2 cut(s) 7, 78
BmrFI CCNGG 2 cut(s) 69, 497
BmsI GCATC 2 cut(s) 202, 313
BpmI CTGGAG 1 cut(s) 458
BpuMI CCSGG 1 cut(s) 497
Bsc4I CCNNNNNNNGG 1 cut(s) 436
Bse3DI GCAATG 2 cut(s) 29, 399
BseBI CCWGG 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 436
BseMI GCAATG 2 cut(s) 29, 399
BseMII CTCAG 2 cut(s) 135, 264
BseRI GAGGAG 2 cut(s) 183, 195
BsgI GTGCAG 1 cut(s) 181
BsiSI CCGG 1 cut(s) 496
BslI CCNNNNNNNGG 1 cut(s) 436
BsmAI GTCTC 1 cut(s) 140
BsmI GAATGC 3 cut(s) 123, 191, 497
Bsp143I GATC 3 cut(s) 52, 83, 256
BspCNI CTCAG 2 cut(s) 136, 265
BspLI GGNNCC 2 cut(s) 7, 78
BspPI GGATC 1 cut(s) 264
BsrDI GCAATG 2 cut(s) 29, 399
BssMI GATC 3 cut(s) 52, 83, 256
BssNAI GTATAC 1 cut(s) 279
BssSI CACGAG 1 cut(s) 516
Bst1107I GTATAC 1 cut(s) 279
Bst2BI CACGAG 1 cut(s) 516
Bst2UI CCWGG 1 cut(s) 69
Bst4CI ACNGT 5 cut(s) 159, 202, 232, 323, 479
BstDEI CTNAG 4 cut(s) 144, 273, 346, 363
BstKTI GATC 3 cut(s) 55, 86, 259
BstMAI GTCTC 1 cut(s) 140
BstMBI GATC 3 cut(s) 52, 83, 256
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 69
BstNSI RCATGY 2 cut(s) 67, 219
BstSCI CCNGG 2 cut(s) 67, 495
BstX2I RGATCY 2 cut(s) 83, 256
BstYI RGATCY 2 cut(s) 83, 256
BstZ17I GTATAC 1 cut(s) 279
BtsIMutI CAGTG 3 cut(s) 52, 164, 484
CviAII CATG 7 cut(s) 37, 64, 73, 169, 216, 331, 569
CviJI RGCY 3 cut(s) 77, 167, 239
CviKI_1 RGCY 3 cut(s) 77, 167, 239
DdeI CTNAG 4 cut(s) 144, 273, 346, 363
DpnI GATC 3 cut(s) 54, 85, 258
DpnII GATC 3 cut(s) 52, 83, 256
EcoRI GAATTC 1 cut(s) 41
EcoRII CCWGG 1 cut(s) 67
EcoT22I ATGCAT 1 cut(s) 217
FaeI CATG 7 cut(s) 40, 67, 76, 172, 219, 334, 572
FatI CATG 7 cut(s) 36, 63, 72, 168, 215, 330, 568
FblI GTMKAC 1 cut(s) 278
FspBI CTAG 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 458
HapII CCGG 1 cut(s) 496
Hin1II CATG 7 cut(s) 40, 67, 76, 172, 219, 334, 572
HincII GTYRAC 1 cut(s) 484
HindII GTYRAC 1 cut(s) 484
HinfI GANTC 3 cut(s) 124, 367, 420
HpaII CCGG 1 cut(s) 496
HphI GGTGA 1 cut(s) 296
Hpy166II GTNNAC 2 cut(s) 279, 484
Hpy188III TCNNGA 4 cut(s) 308, 383, 437, 518
Hpy8I GTNNAC 2 cut(s) 279, 484
HpyAV CCTTC 2 cut(s) 215, 350
HpyCH4III ACNGT 5 cut(s) 159, 202, 232, 323, 479
HpyCH4IV ACGT 1 cut(s) 391
HpyCH4V TGCA 6 cut(s) 20, 34, 89, 121, 162, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 4 cut(s) 144, 273, 346, 363
HpySE526I ACGT 1 cut(s) 391
Hsp92II CATG 7 cut(s) 40, 67, 76, 172, 219, 334, 572
Kzo9I GATC 3 cut(s) 52, 83, 256
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 5 cut(s) 54, 81, 396, 422, 509
LweI GCATC 2 cut(s) 202, 313
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 391
MaeIII GTNAC 1 cut(s) 323
MalI GATC 3 cut(s) 54, 85, 258
MboI GATC 3 cut(s) 52, 83, 256
MboII GAAGA 3 cut(s) 119, 149, 460
MflI RGATCY 2 cut(s) 83, 256
MluCI AATT 3 cut(s) 41, 457, 586
MlyI GAGTC 1 cut(s) 376
MnlI CCTC 6 cut(s) 173, 201, 204, 229, 433, 531
Mph1103I ATGCAT 1 cut(s) 217
MseI TTAA 3 cut(s) 23, 252, 300
MslI CAYNNNNRTG 1 cut(s) 62
MspI CCGG 1 cut(s) 496
MspR9I CCNGG 2 cut(s) 69, 497
Mva1269I GAATGC 3 cut(s) 123, 191, 497
MvaI CCWGG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 26
NciI CCSGG 1 cut(s) 497
NdeII GATC 3 cut(s) 52, 83, 256
NlaIII CATG 7 cut(s) 40, 67, 76, 172, 219, 334, 572
NlaIV GGNNCC 2 cut(s) 7, 78
NmuCI GTSAC 1 cut(s) 323
NsiI ATGCAT 1 cut(s) 217
NspI RCATGY 2 cut(s) 67, 219
PctI GAATGC 3 cut(s) 123, 191, 497
PfeI GAWTC 2 cut(s) 124, 420
PflMI CCANNNNNTGG 1 cut(s) 436
PleI GAGTC 1 cut(s) 375
PpsI GAGTC 1 cut(s) 375
PsiI TTATAA 1 cut(s) 555
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PspN4I GGNNCC 2 cut(s) 7, 78
PsuI RGATCY 2 cut(s) 83, 256
RseI CAYNNNNRTG 1 cut(s) 62
SaqAI TTAA 3 cut(s) 23, 252, 300
Sau3AI GATC 3 cut(s) 52, 83, 256
SchI GAGTC 1 cut(s) 376
ScrFI CCNGG 2 cut(s) 69, 497
SetI ASST 3 cut(s) 226, 394, 542
SfaNI GCATC 2 cut(s) 202, 313
SmiMI CAYNNNNRTG 1 cut(s) 62
Sse9I AATT 3 cut(s) 41, 457, 586
SspMI CTAG 1 cut(s) 81
StyD4I CCNGG 2 cut(s) 67, 495
TaaI ACNGT 5 cut(s) 159, 202, 232, 323, 479
TaiI ACGT 1 cut(s) 394
TaqI TCGA 3 cut(s) 210, 291, 406
TasI AATT 3 cut(s) 41, 457, 586
TfiI GAWTC 2 cut(s) 124, 420
Tru1I TTAA 3 cut(s) 23, 252, 300
Tru9I TTAA 3 cut(s) 23, 252, 300
TscAI CASTG 3 cut(s) 52, 164, 484
TseFI GTSAC 1 cut(s) 323
Tsp45I GTSAC 1 cut(s) 323
TspDTI ATGAA 2 cut(s) 504, 585
TspRI CASTG 3 cut(s) 52, 164, 484
Van91I CCANNNNNTGG 1 cut(s) 436
XapI RAATTY 2 cut(s) 41, 586
XceI RCATGY 2 cut(s) 67, 219
XmiI GTMKAC 1 cut(s) 278
XspI CTAG 1 cut(s) 81
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.