Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000399.1

Orthogroup ID

OG0017379

Physical Location & Seq

Genomic Coordinates Reverse (-)

7318 .. 7718

Gene Structure 401 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000399.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 318 bp

atggcaccagaatatgccattaatggtcaattctctgtaaaatccgacgttttgagctttggcattttattgctggagacattaaccggaaagaggagtagagggtttcatgatcagaaacacaaccttaatctagttggacatgtctggagattgtggaaagaaggaaggtcctttgaggcgattgacgaatgcttaagggaatcatgtactctatcagaagcattgctttgcatacatgttggtcttctatgtgtccaaaagcttcctgaagataggccgaccatgtgggcggtggttctgatgctaggtggttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009506 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0019899 GO:0023052 GO:0030054 GO:0031625 GO:0036211 GO:0038023 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044389 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0055044 GO:0060089 GO:0065007 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin DUF3403 PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

105

Amino Acids

11.82

Weight (kDa)

6.4

Isoelectric Point (pI)

52.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017379)

Species	Orthologous Gene IDs
malus_domestica	MD14G1065700.v1.1 MD17G1084200.v1.1 MD17G1088800.v1.1
prunus_persica	Prupe.3G225600_v2.0.a1
pyrus_communis	pycom17g08510
rosa_laevigata	RLG00000002293
rosa_multiflora	Rmu_sc0000399.1_g000003 Rmu_sc0000955.1_g000016 Rmu_sc0004576.1_g000020
rosa_roxburghii	Rroxscaffold_2G00089350
rosa_rugosa	Rorug02G0485900
rosa_samantha	Rh1BG030900 Rh6BG126100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	4
AciI	CCGC	1 cut(s)	293
AcuI	CTGAAG	1 cut(s)	291
AfaI	GTAC	1 cut(s)	211
AfiI	CCNNNNNNNGG	1 cut(s)	93
AflII	CTTAAG	1 cut(s)	196
AflIII	ACRYGT	2 cut(s)	142, 238
AluBI	AGCT	2 cut(s)	57, 265
AluI	AGCT	2 cut(s)	57, 265
Alw26I	GTCTC	1 cut(s)	71
AoxI	GGCC	1 cut(s)	278
AseI	ATTAAT	1 cut(s)	21
AspS9I	GGNCC	1 cut(s)	171
AvaII	GGWCC	1 cut(s)	171
BanI	GGYRCC	1 cut(s)	4
BbsI	GAAGAC	1 cut(s)	239
BclI	TGATCA	1 cut(s)	112
BcoDI	GTCTC	1 cut(s)	71
BfaI	CTAG	2 cut(s)	134, 308
BfrI	CTTAAG	1 cut(s)	196
Bme18I	GGWCC	1 cut(s)	171
BmgT120I	GGNCC	1 cut(s)	171
BmiI	GGNNCC	1 cut(s)	6
BmsI	GCATC	1 cut(s)	294
BpiI	GAAGAC	1 cut(s)	239
BpmI	CTGGAG	2 cut(s)	95, 169
BsaWI	WCCGGW	1 cut(s)	86
Bsc4I	CCNNNNNNNGG	1 cut(s)	93
Bse3DI	GCAATG	1 cut(s)	224
BseLI	CCNNNNNNNGG	1 cut(s)	93
BseMI	GCAATG	1 cut(s)	224
BseRI	GAGGAG	1 cut(s)	109
BshFI	GGCC	1 cut(s)	280
BshNI	GGYRCC	1 cut(s)	4
BsiSI	CCGG	1 cut(s)	87
BslI	CCNNNNNNNGG	1 cut(s)	93
BsmAI	GTCTC	1 cut(s)	71
BsmI	GAATGC	1 cut(s)	197
BsnI	GGCC	1 cut(s)	280
Bsp143I	GATC	1 cut(s)	112
BspACI	CCGC	1 cut(s)	293
BspANI	GGCC	1 cut(s)	280
BspHI	TCATGA	1 cut(s)	109
BspLI	GGNNCC	1 cut(s)	6
BspT107I	GGYRCC	1 cut(s)	4
BspTI	CTTAAG	1 cut(s)	196
BsrDI	GCAATG	1 cut(s)	224
BssMI	GATC	1 cut(s)	112
BstAFI	CTTAAG	1 cut(s)	196
BstKTI	GATC	1 cut(s)	115
BstMAI	GTCTC	1 cut(s)	71
BstMBI	GATC	1 cut(s)	112
BstNSI	RCATGY	2 cut(s)	146, 242
BstV2I	GAAGAC	1 cut(s)	239
BsuRI	GGCC	1 cut(s)	280
CciI	TCATGA	1 cut(s)	109
Cfr13I	GGNCC	1 cut(s)	171
Csp6I	GTAC	1 cut(s)	210
CviAII	CATG	5 cut(s)	110, 143, 207, 239, 286
CviJI	RGCY	3 cut(s)	57, 265, 280
CviKI_1	RGCY	3 cut(s)	57, 265, 280
CviQI	GTAC	1 cut(s)	210
DpnI	GATC	1 cut(s)	114
DpnII	GATC	1 cut(s)	112
Eco47I	GGWCC	1 cut(s)	171
Eco57I	CTGAAG	1 cut(s)	291
EcoO109I	RGGNCCY	1 cut(s)	171
FaeI	CATG	5 cut(s)	113, 146, 210, 242, 289
FaiI	YATR	8 cut(s)	15, 111, 144, 208, 236, 240, 253, 287
FalI	AAGNNNNNCTT	2 cut(s)	213, 245
FatI	CATG	5 cut(s)	109, 142, 206, 238, 285
FbaI	TGATCA	1 cut(s)	112
FspBI	CTAG	2 cut(s)	134, 308
GsuI	CTGGAG	2 cut(s)	95, 169
HaeIII	GGCC	1 cut(s)	280
HapII	CCGG	1 cut(s)	87
Hin1II	CATG	5 cut(s)	113, 146, 210, 242, 289
HindIII	AAGCTT	1 cut(s)	263
HinfI	GANTC	1 cut(s)	203
HpaII	CCGG	1 cut(s)	87
Hpy188I	TCNGA	4 cut(s)	46, 117, 220, 303
Hpy188III	TCNNGA	3 cut(s)	110, 148, 269
Hpy99I	CGWCG	1 cut(s)	50
HpyAV	CCTTC	2 cut(s)	158, 162
HpyCH4IV	ACGT	1 cut(s)	48
HpyCH4V	TGCA	1 cut(s)	234
HpySE526I	ACGT	1 cut(s)	48
Hsp92II	CATG	5 cut(s)	113, 146, 210, 242, 289
Ksp22I	TGATCA	1 cut(s)	112
Kzo9I	GATC	1 cut(s)	112
LpnPI	CCDG	5 cut(s)	21, 59, 100, 133, 282
LweI	GCATC	1 cut(s)	294
MaeI	CTAG	2 cut(s)	134, 308
MaeII	ACGT	1 cut(s)	48
MalI	GATC	1 cut(s)	114
MboI	GATC	1 cut(s)	112
MboII	GAAGA	2 cut(s)	239, 284
MluCI	AATT	1 cut(s)	29
MmeI	TCCRAC	2 cut(s)	69, 118
MnlI	CCTC	3 cut(s)	87, 95, 172
MseI	TTAA	4 cut(s)	21, 83, 129, 197
MspCI	CTTAAG	1 cut(s)	196
MspI	CCGG	1 cut(s)	87
Mva1269I	GAATGC	1 cut(s)	197
NdeII	GATC	1 cut(s)	112
NlaIII	CATG	5 cut(s)	113, 146, 210, 242, 289
NlaIV	GGNNCC	1 cut(s)	6
NspI	RCATGY	2 cut(s)	146, 242
PagI	TCATGA	1 cut(s)	109
PciI	ACATGT	2 cut(s)	142, 238
PctI	GAATGC	1 cut(s)	197
PfeI	GAWTC	1 cut(s)	203
PpuMI	RGGWCCY	1 cut(s)	171
PscI	ACATGT	2 cut(s)	142, 238
PshBI	ATTAAT	1 cut(s)	21
Psp5II	RGGWCCY	1 cut(s)	171
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	1 cut(s)	171
PspPPI	RGGWCCY	1 cut(s)	171
RsaI	GTAC	1 cut(s)	211
RsaNI	GTAC	1 cut(s)	210
SaqAI	TTAA	4 cut(s)	21, 83, 129, 197
Sau3AI	GATC	1 cut(s)	112
Sau96I	GGNCC	1 cut(s)	171
SetI	ASST	6 cut(s)	51, 59, 129, 173, 267, 313
SfaNI	GCATC	1 cut(s)	294
SinI	GGWCC	1 cut(s)	171
SmlI	CTYRAG	1 cut(s)	196
SmoI	CTYRAG	1 cut(s)	196
Sse9I	AATT	1 cut(s)	29
SsiI	CCGC	1 cut(s)	293
SspMI	CTAG	2 cut(s)	134, 308
TaiI	ACGT	1 cut(s)	51
TasI	AATT	1 cut(s)	29
TatI	WGTACW	1 cut(s)	209
TfiI	GAWTC	1 cut(s)	203
Tru1I	TTAA	4 cut(s)	21, 83, 129, 197
Tru9I	TTAA	4 cut(s)	21, 83, 129, 197
TspDTI	ATGAA	1 cut(s)	98
Vha464I	CTTAAG	1 cut(s)	196
VpaK11BI	GGWCC	1 cut(s)	171
VspI	ATTAAT	1 cut(s)	21
XceI	RCATGY	2 cut(s)	146, 242
XcmI	CCANNNNNNNNNTGG	1 cut(s)	292
XspI	CTAG	2 cut(s)	134, 308

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.